Cell isolation and culture
Primary osteoblasts were prepared from the calvaria of Sprague Dawley (SD) rats (Animal center of Gem Pharmatech Co., Ltd; Nanjing, China). In short, the calvarias of rats (2 weeks after birth) were dissected, washed with PBS and digested in fresh 0.1% collagenase type II in alfa-minimal essential Eagle’s medium (α-MEM) at 37℃ for 40 minutes (repeated for 5 times). After digestion, the supernatant was mixed and centrifuged to pellet cells. The cells were then maintained in α-MEM containing 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin sulfate, at 37℃ with 5% CO2. Next, the medium was replaced with α-MEM containing 1% bovine serum albumin (BSA), and the cells were cultured for 16 hours before preparing for subsequent experiments.
ALP activity analyses
Osteoblasts were evaluated by measuring ALP activity.ALP activity was measured using a commercial kit in accordance with manufacturer's protocols (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).
Alizarin red staining
The capability of mineralization of corresponding cells was assessed in 6-well plates using Alizarin red staining. The indicated cells were fixed with ice-cold 70% ethanol and stained with Alizarin red staining kit (Sigma-Aldrich, MO, USA) to detect the calcification according to the manufacturer's protocols. ImageJ 1.8.0 software was applied to detect the percentages of positive areas, and then quantify the mineralized areas.
Quantitative real-time PCR (qRT-PCR) assays
Total RNA was extracted and purified by Trizol method. cDNA synthesis and quantitative real-time PCR (qRT-PCR) assays were carried out in accordance with manufacturer's protocols (Takara, Tokyo, Japan). The designed primer sequences are as following:
Specific primer sequences for qPCR
Gene
|
Forward(5'-3')
|
Reverse(5'-3')
|
PCNA
Col1
BGLAP
OPN
|
ACTCGCATTGGCTGGCATGG
CACCTGGCGTCTTACTTCGTCTTC
CACTCCTCGCCCTATTGGC
AGCAGCTTGGCCCAGACCTA
|
TGACTACCGCTTTGTGGCTTTGG
GTTGGGCGTGGGCAGTTCAG
CCCTCCTGCTTGGACACAAAG
TAGCGCCGGAGTCTGTTCACTAC
|
GAPDH
|
ACCACAGTCCATGCCATCAC
|
TCCACCACCCTGTTGCTGTA
|
Western Blotting assays
Total cellular protein was extracted using RIPA buffer (Beyotime, Jiangsu, China) and quantified using BCA protein assay kit (Beyotime, Jiangsu, China). The proteins were loaded and electrophoresed separately through a 15% SDS-PAGE gel. The separated proteins were subsequently transferred to the polyvinylidene fluoride membranes (PVDF) membrane and incubated with primary antibodies (rabbit anti-LC3, BCL2, Beclin1 and GAPDH; Cell Signaling Technology, Boston, USA) at 4°C overnight. After washing, the membrane was incubated with the secondary antibody at room temperature for 60 minutes. The immunoreactive bands were visualized using an ECL kit (Millipore, MA, USA) and were quantified using a Chemi-Doc image analyzer (Bio-Rad).
Lentiviral Transduction
Recombinant lentiviruses encoding the wild-type BCL2 or shRNA against Beclin1 were constructed by homologous recombination between the expression vector (pEX-Puro-Lv105) and cDNA/shRNA in 293 cells using the lentivirus construction kit in accordance with manufacturer's protocols. The same method was used to construct and package the corresponding control vector. After 2 days, supernatants were harvested, and primary osteoblasts were incubated in medium containing lentiviruses and 5 μg/ml polybrene at a multiplicity of infection (MOI) of 40 for 2 d. The infected cells were selected using puromycin (10 μg/ml). The overexpression efficiency of viral gene was detected using qPCR analysis.
Coimmunoprecipitation (Co-IP) assays
The total protein was extracted by RIPA Lysis and Extraction Buffer (ThermolFisher Scientific, USA). Subsequently, we rinsed the beads with 100 μL iced buffer, added 100μL antibody-binding buffer to revolve the antibody and magnetic beads for 30 min, and then rinsed the beads 3 times using 200 μL buffer for 5 min each time. Cell lysates and antibody-bound magnetic beads were incubated for 1 hours at room temperature and washed using 200 μL buffer for 5 min each time. 20 μL eluent was used to rinse the beads once and the supernatant was removed. The cell lysates were extracted for Co-IP with anti-BCL2 antibody (Cell Signaling Technology), and subsequently, precipitates were examined using Western Blotting with anti-Beclin1 antibody.
Transmission electron microscopy (TEM) analyses
After treatment with the indicated interventions, the preparation of cell sections, staining, and TEM assays were performed according to manufacturer’s protocols (Servicebio, Wuhan, China). The cell ultrastructures were observed under TEM (Hitachi, Tokyo, Japan).
Statistical analysis
Data are expressed as mean±SEM. Statistical analyses were performed using SPSS19.0. For comparisons, one-way ANOVA or Student's t-test was performed. Tukey test was used for Post-Hoc Multiple Comparisons of one-way ANOVA. Differences were considered signifcant at a threshold of P<0.05.