2.1 Ethical statement
All the participants signed an informed consent form, which was approved by the Ethics Committee of Tongren Hospital, Shanghai Jiao Tong University (Shanghai, China).
2.2 Clinical samples
A total of 30 individuals (10 HPV16 positives, 10 HPV18 positives and 10 controls) were recruited from July to September 2020. Control (CTL) referred to women without HPV infection. The HPV infected participants’ plasma samples were collected at Tongren Hospital, Shanghai, China. The plasma from control groups was from healthy volunteers in the Changning district, Shanghai, China. All participants were aged between 20 and 45 years old and were not pregnant or experiencing menstruation. The sampling was processed by trained gynecologists and followed the approved protocol. All the blood samples were collected in the anticoagulant tubes and centrifuged at 3000 rpm for 15 min at 4 ℃. The supernatant was then transferred into 1.5 ml tubes and stored at -80 ℃ before use.
2.3 Sample preparation
After thawing, about 100 µl of the supernatant sample was added into 10 µl of 2-chloro-L- phenylalanine (0.3 mg/mL) and Lyso PC17:0, 0.01 mg/mL diluted in methanol as internal standard, and then vortexed for 10s. Pre-cold methanol and acetonitrile (2/1, v/v) were mixed and added into the sample, and then vortexed for 1 min, samples were ultrasonically extracted in an ice water bath for 10 min, and held at -20℃ for 30 min. After centrifuging at 13000 rpm at 4°C for 10 min, 300 µL of the supernatant was transferred into the LC-MS vial and evaporated to dryness. Next, 400 µL of methanol and water (1/4, v/v) were applied to each sample, vortexed for 30 s, held at 4℃ for 2 min, and then stored at -20℃. After 30 min, samples were centrifuged at 13000 rpm at 4°C for 10 min. The supernatants were aspirated using syringes, filtered through 0.22 µm microfilters, transferred to LC vials, and finally stored at -80°C.
2.4 Detection of metabolic profiling by LC-MS
Metabolic profiles in both electrospray ionization (ESI) positive and ESI negative ion modes were carried out using an ACQUITY UPLC I-Class system (Waters Corporation, Milford, USA) coupled with an AB SCIEX Triple TOF 5600 System (AB SCIEX, Framingham, MA). The binary gradient elution systems consisted of water containing 0.1% formic acid, v/v (A) and acetonitrile containing 0.1 % formic acid, v/v, (B). The separation was achieved using the following conditions: 20% B for 2 min; 60% B for 4 min; 100% B for 11 min; 100% B for 13 min; 13.5 5% B for 13.5 min and a final 5% B for 14.5 min. All the samples were analyzed at 4°C. The injection volume was 2 µl. In full scan mode (m/z ranges from 70 to 1000) combined with information-dependent acquisition (IDA) mode, data acquisition was performed at a collision energy of 10 eV (+) and − 10 eV (-). Parameters of mass spectrometry were as follows: ion source temperature ranged from 550°C (+) to 550°C (-) throughout the acquisition; ion spray voltage was set from 5500 V (+) to 4500 V (-); curtain gas was 35 PSI; decluttering potential was set between 100 V (+) and − 100 V (-); interface heater temperature was from 550°C (+) to 600°C (-). For IDA analysis, the range of m/z was set as 25-1000, and the collision energy was 30 eV.
2.5 Data analysis
Metabolites were identified and analyzed by public databases (http://www.hmdb.ca/; http://www.lipidmaps.org/) and self-built databases. The distinct tendency among groups was analyzed using principal component analysis (PCA) and orthogonal partial least-squares discriminant analysis (OPLS-DA) models. The variable importance in projection (VIP) > 1 and p values < 0.05 were considered statistically significant. Qualitative and metabolic pathway analyses of differential metabolites were investigated with the Kyoto encyclopedia of genes and genomes (KEGG) online database. Furthermore, the human metabolome database (HMDB) IDs and KEGG IDs of the metabolites were entered into the ingenuity pathway analysis (IPA) server (IPA, Ingenuity® Systems, http://www.ingenuity.com) to analyze networks between metabolites.
2.6 Ceramides purchase
C8 Ceramide-1-Phosphate (d18:1/8:0) (#860532P), C12 Ceramide-1-Phosphate (d18:1/12:0) (#860531P) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Concentration 50 mM stock solution of C8, C12 and were prepared in dimethyl sulfoxide (DMSO) and aliquots of this solution were added to cultures, keeping DMSO concentration below 0.1%, same DMSO was added to controls.
2.7 Cell culture
Hela (ATCC CCL-2) and GH354 (ATCC CRL-13003) was cultured in DMEM (Dulbecco’s modified Eagle’s medium) medium, containing 10% fetal bovine serum (Gibco, New Zealand) and 500 µl penicillin- streptomycin (Gibco, USA), kept in an incubator at 5% CO2 and 37℃. The medium was changed every three days. Cells were digested with 0.05% trypsin (ScienCell, USA) for inoculation and passage when fused to 80%.
2.8 CCK8-assay
The effect of cervical cancer cells proliferation was assayed by CCK8 (TargetMOL, China). Cultured Hela and GH354 cells were suspended in 100 µl culture medium with 10% FBS and inoculated in a 96-well plate (3000 cells/well) along with 0, 5, 10, 20, 30 µM C8, C12 and 10 µl CCK8 solution was added to each well after incubating 24hrs, 48hrs and 72hrs respectively. The plate was incubated for an additional 1 hour before measuring the absorbance at 450 nm wavelength using a microplate reader.
2.9 Cell migration assay
Cultured cells were suspended in a 2ml culture medium with 16% FBS and inoculated in a 6-well plate (100000 cells/well) along with C8 and C12. Control is added with the same DMSO. Migration efficiency was detected at a time of 0hrs, 24hrs, 36hrs and 72hrs, respectively.
2.10 RNA isolation and RT-qPCR analysis
Total RNA was extracted from cells via TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instruction, and reverse transcribed using HiScript®Ⅱ QRT SuperMix (Vazyme, Nanjing, China) for reverse transcription-quantitative PCR (RT-qPCR) to obtain cDNA chain. The target genes were amplified in three replicates by the SYBR Green PCR Master Mix (Vazyme, Nanjing, China). The primers were specific for E-cadherin, N-cadherin, Vimentin, MMP9 and GAPDH as follows: E-cadherin primers (E-cadherin F: ATTTTTCCCTCGACACCCGAT; R: TCCCAGGCGTAGACCAAGA), N-cadherin primers (N-cadherin F: AGCCAACCTTAACTGAGGAGT; R: GGCAAGTTGATTGGAGGGATG), Vimentin primers (Vimentin F: TGCCGTTGAAGCTGCTAACTA; R: CCAGAGGGAGTGAATCCAGATTA), MMP9 primers (MMP9 F: AGACCTGGGCAGATTCCAAAC; R: CGGCAAGTCTTCCGAGTAGT), GAPDH primers (GAPDHF: ACAACTTTGGTATCGTGGAAGG; R: GCCATCACGCCACAGTTTC). The RT-qPCR procedures were as follows: 95°C for 5 seconds, followed by 40 cycles at 95°C for 10s and 60°C for 30 s. Quantified mRNA was normalized to beta-actin as a control. The relative expression of mRNA was determined by the 2-ΔΔCT method.
2.11 Protein extraction and western blot analysis
Cells were prepared by homogenization in the presence of protease inhibitors (Thermo Fisher Scientific, Waltham, MA, USA), and centrifuged to remove cell pellet. The samples were heat-denatured at 95°C for 5 minutes with 5× SDS-PAGE loading buffer and fractionated on 10% SDS-PAGE gels (Bio-Rad, Hercules, CA, USA). GAPDH (HRP-60004, Proteintech, Manchester, UK) was used as a standard control protein. Following electrophoresis, proteins were transferred to a nitrocellulose membrane and blocked with 5% skim milk powder. Primary antibodies used Anti-E-cadherin, Anti-N-cadherin, Anti-MMP9 and Anti-Vimentin antibodies (1;2000, Proteintech, Manchester, UK).
2.12 Statistical analysis
Univariate analysis of variance (ANOVA) quantified the differences between the HR-HPV infected and the CTL groups with GraphPad Prism 6.0. Data were presented as the mean ± standard error (SE). P-values were determined using a two-tailed Student’s t-test or one-way analysis of variance (ANOVA) with a Tukey’s post hoc correction for multiple group comparisons. All data analyses were processed using GraphPad Prism, version 5.0 (GraphPad Software, San Diego, CA). A two-sided P-value of < 0.05 was considered statistically significant. Significance was set as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.