Animals used for the study and ethics committee approval
The study included 35 male Sprague Dawley rats weighing 250-280 g and aged 10-12 weeks. Animals were provided by Atatürk University Experimental Research and Application Center (Erzurum, Turkey). After being randomly assigned into five groups in plastic cages, the rats were housed in an environment with 24±1◦C, 45±5% humidity, and a 12-hour light/dark cycle. Animals were fed standard rodent chow and water ad libitum. Before the experiment, the animals were acclimated to the environment for one week. Approval was obtained for the study from Atatürk University Animal Experiments Ethics Committee (Approval No. 2018/12/217).
Experimental groups
Each experimental group consisted of 7 animals. Doses of CRV and Cd were determined with reference to previous studies by Barnwal et al. (2018)[13] and Kim et al. (2018) [14], respectively. Experimental groups are given below.
1. Control group: Animals were orally given physiological saline for seven days and 30 minutes later were orally administered corn oil.
2. CRV group: Animals were orally administered 50 mg/kg CRV (98% purity, Sigma-Aldrich chemicals, St. Louis, MO, USA) for seven days.
3. Cd group: Animals were orally administered 25 mg/kg cadmium chloride (CdCl2; 99.99% purity, Sigma-Aldrich chemicals, St. Louis, MO, USA) for seven days.
4. Cd+CRV 25 group: Animals were given 25 mg/kg CdCl2 orally for seven days and 25 mg/kg CRV orally 30 min later.
5. Cd+CRV 50 group: Animals were given 25 mg/kg CdCl2 orally for seven days and 50 mg/kg CRV orally 30 min later.
On day 8 of the study (24 hours after the last CRV administration), the animals were decapitated and their lung tissue removed after mild anesthesia with sevoflurane. Subsequently, lung tissue was used for biochemical, Real-Time PCR, and Western blot analyses.
Preparation of tissue homogenates
Rat lung tissue was first frozen with liquid nitrogen and then pulverized with a homogenizer (Tissue Lyser II, Qiagen, Netherlands). In the second phase, the tissues were diluted with 1.15% potassium chloride at a ratio of 1:10 (w/v) and then homogenized using the same homogenizer. Homogenates were centrifuged at 3500 rpm for 15 minutes at +4°C to analyze malondialdehyde (MDA), superoxide dismutase (SOD), and catalase (CAT). For glutathione (GSH) and glutathione peroxidase (GPx) analyses, it was centrifuged at 10000 rpm for 20 min at +4°C.
Analysis of oxidant and antioxidant markers in lung tissue
MDA levels as oxidation markers in lung tissue were analyzed according to the Placer et al. (1966) [15] method. The antioxidant markers SOD, CAT, and GPx activity and GSH levels were analyzed using the methods Sun et al. (1988)[16], Aebi (1984)[17], Lawrence and Burk (1976)[18] and Sedlak and Lindsay (1968)[19] respectively. Total protein levels of lung tissue used to calculate enzymatic antioxidant content were determined according to the method of Lowry et al. (1951)[20].
Analysis of inflammatory markers in lung tissue by ELISA method
Powdered tissue was diluted with phosphate-buffered saline (PBS) at a ratio of 1:20 (w/v) and homogenized with a homogenizer to analyze inflammatory markers in lung tissue by ELISA method. The homogenates obtained were centrifuged at 3500 rpm for 15 minutes at 4 °C. The levels of mitogen-activated protein kinase 14 (p38α MAPK), nuclear factor kappa B (NF-κB), B-cell lymphoma-3 (Bcl-3), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX -2), and prostaglandin E2 (PGE2) in the supernatant separated after centrifugation were analyzed according to the manufacturer's instructions (YL Biont, Shanghai, China).
Analysis of 8-OHdG and MPO in lung tissue by ELISA method
Levels of 8-hydroxy-2′-deoxyguanosine (8-OHdG) and myeloperoxidase (MPO) in lung tissue were determined using commercial ELISA kits from YL Biont (Shanghai, China). The analyses were carried out in strict accordance with the manufacturer's instructions.
Analysis of apoptotic markers in lung tissue by ELISA method
The levels of the apoptotic markers Bcl-2-associated X protein (Bax) and caspase-3 in lung tissue were analyzed using the rat ELISA kit according to the manufacturer's instructions (YL Biont, Shanghai, China). At the end of the analytical process, the color intensity was measured using an ELISA microplate reader (Bio-Tek, Winooski, VT, USA).
RT-PCR analysis in lung tissue
The mRNA transcript levels of tumor necrosis factor α (TNF-α), Interleukin 1 beta (IL -1β), matrix metalloproteinase-2 (MMP-2), and matrix metallopeptidase-9 (MMP-9), whose primary sequences are listed in Table 1, were analyzed in lung tissue through RT -PCR. For this purpose, total RNA was first isolated from the tissue using QIAzol Lysis Reagent (Qiagen, Cat: 79306, Germany). The concentrations of the total RNAs obtained were measured using the NanoDrop instrument (BIO-TEK INSTRUMENTS EPOCH, USA), and the total RNAs of each sample were counterbalanced accordingly. In the next step, cDNA synthesis was performed from the synchronized total RNAs using the iScript™ cDNA Synthesis Kit (BIO-RAD, United States) according to the manufacturer's instructions. mRNA transcript levels were determined on the ROTOR -GENE Q (Qiagen, Germany) instrument using iTaq Universal SYBR Green Supermix (BIORAD) in the final phase. The samples were analyzed in triplicate. b-actin was used as a housekeeping gene. Relative mRNA transcript levels were calculated using CT values from the device and Livak et al.[21]'s −ΔΔCT method.
Table 1. Primer sequences used in the study
Gene
|
Sequences (5’-3’)
|
Length (bp)
|
Accession No
|
TNF-a
|
F: CTCGAGTGACAAGCCCGTAG
R: ATCTGCTGGTACCACCAGTT
|
139
|
NM_012675.3
|
IL-1b
|
F: ATGGCAACTGTCCCTGAACT
R: AGTGACACTGCCTTCCTGAA
|
197
|
NM_031512.2
|
MMP2
|
F: CTCTAGGAGAAGGACAAGTG
R: CTCAAAGTTGTACGTGGTGG
|
158
|
NM_031054.2
|
MMP9
|
F: AGCTGGCAGAGGATTACCTG
R: ATGATGGTGCCACTTGAGGT
|
230
|
NM_031055.2
|
b-Actin
|
F: CAGCCTTCCTTCTTGGGTATG
R: AGCTCAGTAACAGTCCGCCT
|
360
|
NM_031144.3
|
Western blot analysis in lung tissue
The lung tissues were removed and homogenized in RIPA lysis buffer containing protease inhibitör cocktail and PMSF. The samples were centrifuged, and the supernatant was collected. Protein concentration was measured by BCA Protein Assay Kit (Rockford, IL, USA) using bovine serum albumin (BSA) as standard. 30 μg of protein from the supernatant was dissolved in Laemmli sample buffer and separated on 10% sodium dodecyl sulphate polyacrylamide gel (SDS-PAGE). Afterwards, transferred to polyvinylidene fluoride (PVDF) membranes. Blocking was performed by incubating membrane in 5% BSA for 1.5 h at room temperature and subsequently were incubated overnight at 4 °C with primary antibodies against cytochrome c, caspase-3, Bcl-2-associated X protein (Bax), B-cell lymphoma 2 (Bcl-2), beclin-1, and β-actin. After application of the primers, membranes were washed 5 times in PBST for 5 min and left for 1.5 h in the presence of goat anti-mouse IgG secondary antibody (1:2000 dilution, sc-2005). Protein bands were detected using enhanced chemiluminescence reagent Western ECL Substrate (Bio-Rad, Hercules, USA) and visualized with using ImageQuant LAS 500 (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). Relative density of the bands was quantitied with using Image J software (NIH, Bethesda, USA).
Statistical Analysis
Statistical evaluation of the data obtained from biochemical, RT-PCR and western blot analyzes in the study was performed with one-way variance analysis (ANOVA) and Tukey's multiple comparison test in SPSS 20.0 program. Results are presented as mean ± SD. P<0.05 was considered statistically significant.