Association Between MUC1 rs4072037 Polymorphism and Helicobacter Pylori in Patients With Gastric Cancer

doi:10.21203/rs.3.rs-925792/v1

PDF

Research Article

Association Between MUC1 rs4072037 Polymorphism and Helicobacter Pylori in Patients With Gastric Cancer

https://doi.org/10.21203/rs.3.rs-925792/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 28 Sep, 2021

You are reading this latest preprint version

Background: The MUC1 gene encodes glycoproteins attached to cell membrane that play a protective role in gastric cancer and protect epithelial surfaces against external factors such as H. pylori. H. pylori infection can induce a cascade of innate and acquired immune responses in gastric mucosa. This study investigated the relationship between rs4072037G>A polymorphism of MUC1 gene and increased susceptibility to H. pylori infection in patients with gastric cancer in Mazandaran province, northern Iran.

Method: A case-control study was conducted in 99 patients with gastric cancer (H. pylori positive and negative) and 98 controls (H. pylori positive and negative) without gastric cancer (confirmed by pathological biopsy samples obtained during endoscopy). H. pylori infection was diagnosed by histological examination using Giemsa staining. Genomic DNA extracted from peripheral blood was analyzed by PCR-RFLP technique.

Results: Analysis of all genetic models showed no significant relationship between rs4072037G>A polymorphism and risk of gastric cancer (GC). We investigated the relationship between H. pylori infection and rs4072037G>A polymorphism in increasing the susceptibility to gastric cancer in both positive and negative H. pylori groups (including case and control groups). The genetic model of GA/GG and H. pylori- positive versus GA/GG and H. pylori-negative showed a significantly increased susceptibility to gastric cancer (OR=0.251, CI: 0.128-0.493, p=0.000).

Conclusion: These findings indicate that rs4072037G>A polymorphism may interact with H. pylori infection to increase the risk of GC.

Epigenetics & Genomics

Gastric Cancer

H. pylori

MUC1 5640G>A polymorphism

PCR-RFLP

Genotype

Cardiac and non-cardiac gastric cancers are common all over the world. Gastric cancer with more than 1,000,000 new cases and 783,000 deaths (about 1 in 12 deaths worldwide) is the fifth most common cancer in the world and was the third leading cause of cancer death in 2018 (1). The prevalence of gastric cancer is more than twice as high in men as that in women. Gastric cancer is the most common cancer in men and the leading cause of death in several West Asian countries such as Iran, Turkmenistan, and Kyrgyzstan (1). Prevalence rate of gastric cancer in Iran is reported to be as high as 7300 cases per year and is the most common cancer among both sexes (2). Gastric cancer is highly prevalent in northern provinces of Iran, including Mazandaran, Golestan, and Ardabil (3, 4). Involvement of different environmental factors such as alcohol, smoking, diet (high salt intake and low fruit consumption), and infectious agents like H. pylori are investigated or shown in gastric cancer (1).

The prevalence of H. pylori infection varies in different countries. H. pylori contamination is prevalent in about 70% of Iranian people (5) and is responsible for 90% of new cases of noncardiac gastric cancer (1). H. pylori is a gram-negative, microaerophilic and flagellate bacterium (6). Most people are exposed to H.pylori infection during childhood and usually develop gastritis during lifetime. The bacterium causes chronic inflammation and significantly increases the risk of developing gastric ulcer disease and gastric cancer which is the result of H.pylori binding to gastric mucosal epithelial cells, inducing an inflammatory response, gastric epithelial cells mutation, inhibition of apoptosis, stimulation of angiogenesis, and cell proliferation (7, 8).

MUC1 gene encodes a membrane-bound glycoprotein that binds to upper surface of the gastrointestinal epithelium by a transmembrane domain and protects epithelial surfaces against harmful environmental factors (9, 10). There are three types of mucin, two secretories, MUC5AC and MUC6, and a membrane bound, MUC1, which is dominant in gastric mucus (11, 12). MUC1 is known as a tumor-associated molecule in many cancers due to overexpression and abnormal glycolysis (13). This gene is involved in transformation of malignancy by regulating the function of beta-catenin and p53 (14). MUC1 rs4072037 polymorphism (ref SNP ID: 5640; G > A) is located in exon 2 of the MUC1 gene. This polymorphism is involved in alternative splicing which can produce two different products: a full-length transcription or an incomplete transcription product without a TR domain. The conversion of variant A (ACGG) to variant B (ACAG) leads to creation of a new splicing acceptor position. Allele G and A rs4072037 polymorphism lead to long and short VNTR, respectively. The rs4072037A allele causes deletion of 9 amino acids in MUC1 gene product. It is believed that, as a result, this truncated non-functional protein increases the risk of gastric cancer (14–18).

The length of VNTR allele of the MUC1 gene affects susceptibility to H. pylori (19). It is reported that the smallest size of VNTR allele is associated with H. pylori infection (13) which then alters the structure and function of gastric epithelial mucins. MUC1 and MUC5AC are major known mucins that play a protective role against H.pylori in carcinogenic process (20). In this study, we evaluated the association between rs4072037 G > A polymorphism of MUC1 gene and susceptibility to H. pylori in patients with gastric cancer (H.pylori positive or negative) compared with healthy individuals (H. pylori positive or negative).

Population study

The study included 99 patients with gastric cancer (78 males and 19 females, mean age: 66.11 ± 9.1 years) attending outpatient chemotherapy and oncology wards in Comprehensive Cancer Center in Sari Imam Khomeini Hospital, Iran. The patients were selected based on clinical signs, tumor location, and tumor grade and stage according to WHO criteria. Also, 98 control samples (78 men and 19 women, mean age: 56.95 ± 18.4 years) were selected from patients in Sari Imam Khomeini Hospital due to unknown gastrointestinal problems. Pathological examination of endoscopic biopsy specimens of these patients showed no signs of gastric cancer. The presence of H.pylori in gastric biopsy specimens was determined using Giemsa staining. This research was approved by the Ethics Committee in the Mazandaran University of Medical Sciences (IR.MAZUMS.IMAMHOSPITAL. REC.1398.6561). Sampling from patients and controls were applied after filling an informed consent form, which is taken from all participants in this research.

DNA extraction

Peripheral venous blood (5 ml) was collected in a tube containing EDTA and stored at minus 80°C. Blood samples were taken from patients before chemotherapy. Also, blood samples were taken from the control group after endoscopy of patients with gastrointestinal symptoms and confirmation of no cancerous mass by a gastroenterologist. Control group with malignant biopsy specimens who were confirmed by pathology examination were excluded from the study. Genomic DNA was extracted using a blood DNA extraction kit (Denazist, Iran) according to the manufacturer's instructions.

Genotype analysis

PCR-RFLP method was used to analyze the polymorphism of rs4072037G > A MUC1 gene. A fragment of 188 bp PCR containing polymorphism rs4072037G > A of MUC1 gene with a total reaction volume of 25 µl was amplified using two primers: Forward: TAAAGACCCAACCCTATGACT and Reverse: AGAGTACGCTGCTGGTCATACTC. A reaction mixture containing 2 µl of template DNA, 12 µl of 2x PCR Master Mix RED (Amplicon, Denmark), 10 µl of distilled water, and 0.3 µl of both forward and reverse primers. PCR reactions were performed under the following conditions: 94 ° C for 5 minutes followed by 35 cycles of 94 ° C for 60 seconds and 72 ° C for 60 seconds. The annealing temperature was set at 60 ° C for 60 seconds and PCR product was observed on 1% agarose gel containing Green Viewer ™ DNA dye. The 188 bp PCR products were digested using ALWNI restriction enzyme for 5 hours at 37 ° C according to the conditions mentioned in the enzyme protocol (Thermo-Fisher Scientific, USA). After enzymatic digestion, the products were observed by 2% agarose gel electrophoresis containing Green Viewer ™ DNA dye. Enzymatic digestion products included: undigested homozygous GG genotype (188 bp), digested AA homozygous genotype (114 and 74 bp), and heterozygous GA genotype produced three fragments of 188, 114 and 74 bp (Fig. 1).

Statistical analysis

Statistical analysis was performed using SPSS V22 software package, (SPSS, Chicago, IL, USA). Chisquare test was used to evaluate the differences in distributions of demographic characteristics between gastric cancer patients and normal controls. The expected frequency of control genotypes was tested against Hardy–Weinberg equilibrium. The odds ratio (OR) and 95% confidence interval (CI) were calculated using a logistic regression model. P < 0.05 was considered statistically significant. Otherwise, the pooled ORs and 95% CIs without adjustments were calculated for frequencies of rs4072037 G > A alleles and genotypes, respectively.

Demographic and pathological information of 99 case group (H.pylori-negative and H.pylori-positive subgroups) and 98 control group (H.pylori-negative and H.pylori -positive subgroups) are summarized in Tables 1 and 2, respectively. In this study, no significant relationship was observed between rs4072037 G > A polymorphism of MUC1 gene and risk of gastric cancer in all genetic models (Table 3). The genotype and allelic frequency of rs4072037 G > A and their relationship with gastric cancer and H. pylori risk are summarized in Tables 4, 5. Also, the relationship between rs4072037 G > A polymorphism genotypes and pathological features of gastric tumor are summarized in Table 6. In this study, we investigated the relationship between rs4072037G > A polymorphism genotypes and H. pylori in case and control groups with increased susceptibility to gastric cancer. Findings showed no significant relationship between frequencies of GG, GA, and AA genotypes and negative H. pylori and positive H. pylori in case and control groups (p = 0.760 and p = 0.785, respectively) (Table 4). When the GA/GG genotype of rs4072037G > A polymorphism was considered as a reference in negative H. pylori group, a significant difference was found between GA/GG genotype frequencies in positive H. pylori group (OR = 0.251, 95% CI: 0.128–0.493, p = 0.000) (Table 5). From 98 individuals in control group who underwent endoscopy (due to significant gastrointestinal problems), 49 (50%) were diagnosed with gastritis. This result was confirmed by pathologic examination (Table 7).

Table 1

Demographic characteristics of the cases and controls groups.
Sex	Control	Case	p-value
Male	71(72.4)	80(80.8)	0.181
Female	27(27.6)	19(19.2)	0.181
Age	56.95 ± 18.4	66.11 ± 9.1	0.000

Table 2

Tumor characteristics, including tumor site, tumor grade, lymphatic invasion, perineural invasion, tumor stage and tumor type (n = 99).
Characteristics		n	Percentage
Tumor site	Cardia	16	16.2
Tumor site	Non-Cardia	83	83.8
Grade	1	6	6.1
	2	56	56.6
	3	37	37.4
Lymphatic invasion	Present	62	62.6
Lymphatic invasion	Absent	37	37.4
Perineural invasion	Present	36	36.4
Perineural invasion	Absent	63	63.6
T	1	1	1.0
	2	37	37.4
	3	50	50.5
	4	11	11.1
N	0	25	25.3
	1	32	32.3
	2	35	35.4
	3	7	7.1
M	0	71	71.7
M	1	28	28.3
Stage	1	17	17.2
	2	32	32.3
	3	24	24.2
	4	26	26.3
Tumor type	Diffuse	59	60.2
Tumor type	Intestinal	39	39.8

Table 3

Comparison of genotype and allele frequencies of *MUC1* gene polymorphisms between gastric cancer patients (n = 99) and normal controls (n = 98) using chi-square analysis.
SNP^a	Genotype/Allele	Controls(n = 98)	Cases(n = 99)	OR^b (95% CI^c)	P-value
MUC1 5640G > A (rs4072037)	AA	21(21.4)	16(16.2)	-	-
	GA	43(43.9)	47(47.5)	0.697 (0.323–1.507)	0.359
	GG	34 (34.7)	36(36.4)	0.720 (0.323–1.604)	0.421
	GA + GG	77 (78.6)	83 (83.8)	0.707 (0.344–1.453)	0.345
	GA + AA	64 (65.3)	63 (63.6)	0.930 (0.519–1.667)	0.807
	AA + GG	55 (56.1)	52 (52.5)	0.865 (0.494–1.516)	0.612
	A	85(43.4)	79(39.9)	-	-
	G	111(56.6)	119(60.1)	0.867 (0.581–1.294)	0.485

Table 4

Interaction of polymorphism genotypes rs4072037G > A in case and control groups with negative and positive *H. pylori* infection
H. pylori status	Genotypes	Controls(n = 98)		Cases(n = 99)		P-value
		n	%	n	%
-	GG	27	36.5	19	43.2	0.760
	GA	31	41.9	17	38.6
	AA	16	21.6	8	18.2
+	GG	7	29.2	17	30.9	0.785
	GA	12	50.0	30	54.5
	AA	5	20.8	8	14.5
Total	GG	34	34.7	36	36.4	0.636
	GA	43	43.9	47	47.5
	AA	21	21.4	16	16.2

Table 5

Joint effects of *H. pylori* seropositivity and variants of the rs4072037 polymorphism on risk of GC.
H. pylori status	Genotypes	Controls(n = 98)		Cases(n = 99)		OR(95% CI)	P-value
		n	%	n	%
-	GA + GG	58	59.1	36	36.3	-	-
-	AA	16	16.4	8	8.1	1.241(0.482–3.194)	0.654
+	GA + GG	19	19.4	47	47.5	0.251(0.128–0.493)	0.000
+	AA	5	5.1	8	8.1	0.388(0.118–1.278)	0.120

Table 6

Distribution of genotypes *MUC1* rs4072037G > A by tumor characteristics
Variable		rs4072037
Variable		GG	GA	AA	p-value	GG + GA	p-value	AA + GA	p-value
Tumor site	Cardia	6 (37.5)	7 (43.8)	3 (18.8)	0.932	13(81.2)	0.719	10(62.5)	1.000
Tumor site	Non-Cardia	30 (36.1)	40 (48.2)	13(15.7)	0.932	70(84.3)	0.719	53(63.9)	1.000
Grade	I	1 (16.7)	4 (66.7)	1(16.7)	0.376	5(83.3)	0.232	5(83.3)	0.386
	II	19 (33.9)	25 (44.6)	12 (21.4)		44(78.6)		37(66.1)
	III	16 (43.2)	18 (48.6)	3(8.1)		34(91.9)		21(56.8)
Lymphatic invasion	Present	25 (40.3)	28 (45.2)	9 (14.5)	0.554	53(85.5)	0.583	37(59.7)	0.388
Lymphatic invasion	Absent	11 (29.7)	19 (51.4)	7 (18.9)	0.554	30(81.1)	0.583	26(70.3)	0.388
Perineural invasion	Present	11 (30.6)	19 (52.8)	6 (16.7)	0.648	30(83.3)	1.000	25(69.4)	0.394
Perineural invasion	Absent	25 (39.7)	28 (44.4)	10 (15.9)	0.648	53(84.1)	1.000	38(60.3)	0.394
T	T1	0(0.0)	0(0.0)	1(100.0)	0.413	0(0.0)	0.144	1(100.0)	0.772
	T2	14(37.8)	18(48.6)	5(123.5)		32(86.5)		23(62.2)
	T3	17(34.0)	25(50.0)	8(16.0)		42(84.0)		33(66.0)
	T4	5(45.5)	4(36.4)	2(18.2)		9(81.8)		6(54.5)
N	N0	7(28.0)	14(56.0)	4(16.0)	0.745	21(84.0)	0.519	18(72.0)	0.767
	N1	13(40.6)	16(50.0)	3(9.4)		29(90.6)		19(59.4)
	N2	13(37.1)	14(40.0)	8(22.9)		27(77.1)		22(62.9)
	N3	3(42.9)	3(42.9)	1(14.3)		6(85.7)		4(57.1)
M	M0	28(39.4)	33(46.5)	10(14.1)	0.503	61(85.9)	0.377	43(60.6)	0.360
M	M1	8(28.6)	14(50.0)	6(21.4)	0.503	22(78.6)	0.377	20(71.4)	0.360
Stage	I	5 (29.4)	9 (52.9)	3 (17.6)	0.588	14(82.4)	0.311	12(70.6)	0.493
	II	14 (43.8)	15 (46.9)	3 (9.4)		29(90.6)		18(56.2)
	III	10 (41.7)	11 (45.8)	3 (12.5)		21(87.5)		14(58.3)
	IV	7 (26.9)	12 (46.2)	7 (26.9)		19(73.1)		19(73.1)
Tumor type	Diffuse	19 (32.2)	29 (49.2)	11 (18.6)	0.593	48(81.4)	0.580	40(67.8)	0.396
Tumor type	Intestinal	16 (41.0)	18 (46.2)	5 (12.8)	0.593	34(87.2)	0.580	23(59)	0.396

Table 7

Distribution of rs4072037G > A polymorphism genotypes in control group (*H.Pylori*-Positive and *H.Pylori*-Negative) with gastritis and without gastritis.
Rs4072037	Control Group (n = 98)
Rs4072037	Gastritis/H.Pylori-positive	Gastritis/H.Pylori-Negative	Without gastritis/H.Pylori-positive	Without gastritis/H.Pylori-Negative
GG	6	11	1	16
GA	12	8	0	23
AA	5	7	0	9
Total	23	26	1	48

The human mucin (MUC) family consists of MUC1 to MUC21, which are classified into secretory (e.g. MUC2, MUC5AC, MUC5B, and MUC6) and transmembrane members (e.g., MUC1, MUC4, and MUC20) (21). MUC1, MUC4, MUC13, and MUC16 are single pass type I transmembrane proteins and act as a protective mucus gel through their O-glycosylated repetitive ectodomines. The MUC1 N-terminal subunit (MUC1-N) contains highly conserved 20 amino acid tandem repeats that are extensively modified by O-glycans. Alterations in glycosyl-transferase expression in malignant cells leads to glycosylation of MUC1-N tandem repeats (22). According to evidence, homozygous AA genotype (small size VNTR) is associated with an increased risk of H. pylori infection and gastric cancer (23–28).

In this study, allelic comparison (G vs. A) and genotype comparison (GA vs. AA; GG vs. AA) were done and dominant model (AG + AA vs. GG), recessive model (AA vs. AG + GG), and over-dominant model (AA + GG vs. AG) were tested (29). We tested samples from case group with gastric cancer and hospital-based control group without gastric cancer to evaluate the association between rs4072037 polymorphism and H. pylori with susceptibility to gastric cancer. In our previous study in 91 patients with gastric cancer and 96 population-based control group, a significant relationship was observed between rs4072037G > A polymorphism and susceptibility to gastric cancer (30). The present study, unlike our former report, did not show a significant association between rs4072037G > A and risk of gastric cancer. Fifty individuals with gastritis were investigated as controls in this study and this may contradict the result if rs4072037G > A play a role in susceptibility to gastric cancer. similarly, a meta-analysis by Xinyang Liu et al. included a hospital-based control group with gastritis and a healthy population-based control group. In that analysis, hospital-based control group limited the role of rs4072037 polymorphism of MUC1 gene in carcinogenesis (31).

Silva et al. reported that Colombian and Portuguese patients with chronic gastritis were genetically different in VNTR locus. They showed that smaller VNTR genotypes of the MUC1 gene increase susceptibility to intestinal metaplasia in Colombian patients with gastritis. They also observed that MUC1 gene polymorphism is involved in development of chronic atrophic gastritis and intestinal metaplasia, which is a precursor to gastric carcinoma (32). Moreover, immunohistochemical analysis of 95 patients with gastritis in Northern Europe showed that the length of functional allele of MUC1 gene is involved in susceptibility to gastritis (33).

H. pylori causes a wide range of gastrointestinal injuries from gastric ulcers to gastric adenocarcinoma (34). MUC1 membrane mucosa is abnormally expressed in different cancers and in the stomach, it is a ligand for H. pylori and plays a key role in gastric carcinogenesis (18). MUC1 is involved in negative regulation of NLRP3 inflammation by regulating NF-κB nuclear factor pathway. Regulation of NLRP3 inflammatory activity by MUC1 is critical for prevention of severe gastritis (22). Variable number of 20 amino-acid tandem repeat units (VNTR) lead to polymorphisms in the extracellular domain MUC1. People infected with H. pylori with shorter TRs are more susceptible to gastritis and increased risk of stomach cancer (33).

Functional polymorphism rs4072037 in MUC1 gene involved in inflammatory response in patients with H. pylori is significantly associated with a predisposition to gastric cancer (26). An immunohistochemical analysis based on TR antibody showed that H. pylori may react with TR domain of MUC1 on the surface of gastric epithelium and stimulate shedding and internalization. Also, an association was found between functional allele length differences in response to H. pylori (33). The association between small sizes of VNTR and increased risk of H. pylori infection is confirmed (35) and homozygote Short-Short (SS) VNTR of the MUC1 gene is reported to be associated with H. pylori compared to the Long-Long (LL) genotype (36, 37). Other studies also found an association between SS genotype versus LL MUC6 VNTR and the risk of H. pylori (36). Plummer et al. found that 89% of patients with non-cardiac gastric cancer were infected with H. pylori (38), however, other studies did not report a significant association between rs4072037 polymorphism of MUC1 gene and H. pylori with gastric cancer (39, 40).

In this study, using different genotypic models (AA genotype of negative H. pylori group vs GA/GG negative genotype of H. pylori and AA and GA/GG genotypes of H. pylori positive vs GA/GG genotype of negative H. pylori), we investigated the association between H. pylori and rs4072037G > A polymorphism and risk of gastric cancer. In our study, GA/GG genotype and H. pylori were significantly associated with an increased risk of gastric cancer (OR = 0.251, 95% CI: 0.128–0.493, p = 0.000).

We did not find a significant association between rs4072037G > A polymorphism of the MUC1 gene and an increased risk of gastric cancer. We suggest that the lack of association between rs4072037G > A polymorphism and gastric cancer is due to the presence of 50% with gastritis in the control group (hospital-based). These findings indicate that rs4072037G > A polymorphisms may play a role in susceptibility to gastritis. Also, in current study, small population size may explain the lack of association between rs4072037G > A polymorphism and gastric cancer. We suspect that rs4072037G > A polymorphisms and H. pylori may play a role in susceptibility to gastric cancer. The evidence from this study showed the major impact of gene-environment interactions in etiology of gastric cancer. Future works with larger sample size are needed in Iranian populations and other ethnicities to prove current findings.

MUC1: Mucin1

H. pylori: Helicobacter pylori

OR: Odds ratio

GC: Gastric cancer

PCR: Polymerase chain reaction

RFLP: Restriction Fragment Length Polymorphism

SNP: Single nucleotide polymorphisms

WHO: World Health Organization

EDTA: Ethylenediaminetetraacetic acid

VNTR: Variable number of tandem repeats

NLRP3: NOD-, LRR- and pyrin domain-containing protein 3

NF-κB: Nuclear factor kappa B

Ethics approval and consent to participate

Ethical approval for the study was granted by the Mazandaran University of Medical Sciences (Sari Imam Khomeini Hospital) before the study was conducted (approval number: IR.MAZUMS.IMAMHOSPITAL.REC.1398.6561). All experiments were performed in accordance with relevant medical guidelines and global and local regulations. In our samples, there was no any less than 16 year and also all participants provided signed, written informed consent before study entry. Sampling from patients and controls were applied after filling an informed consent form, which is taken from all participants in this research.

Consent for publication

Not Applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the author for correspondence upon reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

The current study was financially supported by Mazandaran University of Medical Sciences (Grant No. 6561). The funding bodies played no role either in the design of the study, data collection, analysis, interpretation of data, or in the writing of the manuscript.

Authors' contributions

M.B.H.S. and R.S.H. conceived and designed the study.

H.J. collected samples based on pathological features.

R.A. and H.J. performed the experiments.

R.A.N. and R.A. analyzed and Interpreted the data.

R.S.H. and M.B.H.S. and R.A. wrote and edited the manuscript.

All authors read and approved the final manuscript.

Acknowledgements

The authors gratefully acknowledge the financial support of Mazandaran University of Medical Sciences and collaboration of Cancer Registration Center at Mazandaran University of Medical Sciences and all the volunteers who participated in this study.

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians. 2018;68(6):394–424.
Farmanfarma KK, Mahdavifar N, Hassanipour S, Salehiniya H. Epidemiologic Study of Gastric Cancer in Iran: A Systematic Review. Clinical and Experimental Gastroenterology. 2020;13:511.
Malekzadeh R, Derakhshan MH, Malekzadeh Z. Gastric cancer in Iran: epidemiology and risk factors. 2009.
Pourfarzi F, Whelan A, Kaldor J, Malekzadeh R. The role of diet and other environmental factors in the causation of gastric cancer in Iran—a population based study. International journal of cancer. 2009;125(8):1953–60.
Eghbali Z, Mojtahedi A, Ansar MM, Asl SF, Aminian K. Detection of 23SrRNA mutations strongly related to clarithromycin resistance in Helicobacter pylori strains isolated from patients in the north of Iran. Jundishapur journal of microbiology. 2016;9(2).
Ruggiero P. Helicobacter pylori and inflammation. Current pharmaceutical design. 2010;16(38):4225–36.
Chiba T, Marusawa H, Seno H, Watanabe N. Mechanism for gastric cancer development by Helicobacter pylori infection. Journal of gastroenterology and hepatology. 2008;23(8pt1):1175–81.
Lillehoj EP, Guang W, Ding H, Czinn SJ, Blanchard TG. Helicobacter pylori and gastric inflammation: Role of MUC1 mucin. Journal of pediatric biochemistry. 2012;2(3):125–32.
Gendler SJ. MUC1, the renaissance molecule. Journal of mammary gland biology and neoplasia. 2001;6(3):339–53.
Sun H, Wu X, Wu F, Li Y, Yu Z, Chen X, et al. Associations of genetic variants in the PSCA, MUC1 and PLCE1 genes with stomach cancer susceptibility in a Chinese population. PloS one. 2015;10(2):e0117576.
Radziejewska I, Leszczyńska K, Borzym-Kluczyk M. Influence of monoclonal anti-Lewis b, anti-H type 1, and anti-sialyl Lewis x antibodies on binding of Helicobacter pylori to MUC1 mucin. Molecular and cellular biochemistry. 2014;385(1):249–55.
Díaz P, Valenzuela Valderrama M, Bravo J, Quest AF. Helicobacter pylori and gastric cancer: adaptive cellular mechanisms involved in disease progression. Frontiers in Microbiology. 2018;9:5.
Bafna S, Kaur S, Batra SK. Membrane-bound mucins: the mechanistic basis for alterations in the growth and survival of cancer cells. Oncogene. 2010;29(20):2893–904.
Zhang L, Vlad A, Milcarek C, Finn OJ. Human mucin MUC1 RNA undergoes different types of alternative splicing resulting in multiple isoforms. Cancer Immunology, Immunotherapy. 2013;62(3):423–35.
Saeki N, Ono H, Yanagihara K, Aoyagi K, Sasaki H, Sakamoto H, et al. rs2294008T, a risk allele for gastric and gallbladder cancers, suppresses the PSCA promoter by recruiting the transcription factor YY 1. Genes to Cells. 2015;20(5):382–91.
Wen R, Gao F, Zhou C-J, Jia Y-B. Polymorphisms in mucin genes in the development of gastric cancer. World journal of gastrointestinal oncology. 2015;7(11):328.
Xu Q, Yuan Y, Sun L-P, Gong Y-H, Xu Y, Yu X-W, et al. Risk of gastric cancer is associated with the MUC1 568 A/G polymorphism. International journal of oncology. 2009;35(6):1313–20.
Ng W, Loh A, Teixeira A, Pereira S, Swallow D. Genetic regulation of MUC1 alternative splicing in human tissues. British journal of cancer. 2008;99(6):978–85.
Ng GZ, Menheniott TR, Every AL, Stent A, Judd LM, Chionh YT, et al. The MUC1 mucin protects against Helicobacter pylori pathogenesis in mice by regulation of the NLRP3 inflammasome. Gut. 2016;65(7):1087–99.
Hu L, Chen W, Cheng M, Zhang T, Lan S, Li P, et al. MUC1 and MUC5AC Acting on Helicobacter pylori-Related Deficiency and Solid Syndrome of Spleen and Stomach. Evidence-Based Complementary and Alternative Medicine. 2018;2018.
Voynow JA. Mucins. 2020.
Kufe DW. Mucins in cancer: function, prognosis and therapy. Nature Reviews Cancer. 2009;9(12):874–85.
Ligtenberg MJ, Gennissen AM, Vos HL, Hilkens J. A single nucleotide polymorphism in an exon dictates allele dependent differential splicing of episialin mRNA. Nucleic acids research. 1991;19(2):297–301.
Imbert Y, Darling DS, Jumblatt MM, Foulks GN, Couzin EG, Steele PS, et al. MUC1 splice variants in human ocular surface tissues: possible differences between dry eye patients and normal controls. Experimental eye research. 2006;83(3):493–501.
Kim BS, Lee I, Yook JH, Song K, Kim B-S. Association between the MUC1 rs4072037 Polymorphism and Risk of Gastric Cancer and Clinical Outcomes. Journal of Gastric Cancer. 2020;20(2):127.
Li M, Huang L, Qiu H, Fu Q, Li W, Yu Q, et al. Helicobacter pylori infection synergizes with three inflammation-related genetic variants in the GWASs to increase risk of gastric cancer in a Chinese population. PloS one. 2013;8(9):e74976.
Jia Y, Persson C, Hou L, Zheng Z, Yeager M, Lissowska J, et al. A comprehensive analysis of common genetic variation in MUC1, MUC5AC, MUC6 genes and risk of stomach cancer. Cancer Causes & Control. 2010;21(2):313–21.
Carvalho F, Seruca R, David L, Amorim A, Seixas M, Bennett E, et al. MUC1 gene polymorphism and gastric cancer–an epidemiological study. Glycoconjugate journal. 1997;14(1):107–11.
Horita N, Kaneko T. Genetic model selection for a case–control study and a meta-analysis. Meta gene. 2015;5:1–8.
Alikhani R, Taravati A, Hashemi-Soteh MB. Association of MUC1 5 640G > A and PSCA 5057C > T polymorphisms with the risk of gastric cancer in Northern Iran. BMC Medical Genetics. 2020;21(1):1–8.
Liu X, Wang Z, Zhang X, Chang J, Tang W, Gan L, et al. MUC1 gene polymorphism rs4072037 and susceptibility to gastric cancer: a meta-analysis. Springerplus. 2014;3(1):1–8.
Silva F, Carvalho F, Peixoto A, Teixeira A, Almeida R, Reis C, et al. MUC1 polymorphism confers increased risk for intestinal metaplasia in a Colombian population with chronic gastritis. European journal of human genetics. 2003;11(5):380–4.
Vinall LE, King M, Novelli M, Green CA, Daniels G, Hilkens J, et al. Altered expression and allelic association of the hypervariable membrane mucin MUC1 in Helicobacter pylori gastritis. Gastroenterology. 2002;123(1):41–9.
Dhar P, Ng GZ, Sutton P. How host regulation of Helicobacter pylori-induced gastritis protects against peptic ulcer disease and gastric cancer. American Journal of Physiology-Gastrointestinal and Liver Physiology. 2016;311(3):G514-G20.
Reis CA, David L, Carvalho F, Mandel U, Bolós Cd, Mirgorodskaya E, et al. Immunohistochemical study of the expression of MUC6 mucin and co-expression of other secreted mucins (MUC5AC and MUC2) in human gastric carcinomas. Journal of Histochemistry & Cytochemistry. 2000;48(3):377–88.
Nguyen TV, Janssen MJ, Gritters P, te Morsche RH, Drenth JP, van Asten H, et al. Short mucin 6 alleles are associated with H pylori infection. World journal of gastroenterology: WJG. 2006;12(37):6021.
Peleteiro B, Lunet N, Santos-Silva F, David L, Figueiredo C, Barros H. Short mucin 1 alleles are associated with low virulent H pylori strains infection. World Journal of Gastroenterology: WJG. 2007;13(12):1885.
Plummer M, Franceschi S, Vignat J, Forman D, de Martel C. Global burden of gastric cancer attributable to Helicobacter pylori. International journal of cancer. 2015;136(2):487–90.
Zhang B, Hao G-Y, Gao F, Zhang J-Z, Zhou C-J, Zhou L-S, et al. Lack of association of common polymorphisms in MUC1 gene with H. pylori infection and non-cardia gastric cancer risk in a Chinese population. Asian Pacific Journal of Cancer Prevention. 2013;14(12):7355–8.
Kupcinskas J, Wex T, Link A, Bartuseviciute R, Dedelaite M, Kevalaite G, et al. PSCA and MUC1 gene polymorphisms are linked with gastric cancer and pre-malignant gastric conditions. Anticancer research. 2014;34(12):7167–75.

No competing interests reported.

PDF

Version 1

posted 28 Sep, 2021

You are reading this latest preprint version

Association Between MUC1 rs4072037 Polymorphism and Helicobacter Pylori in Patients With Gastric Cancer

Status:

Version 1

Abstract

Figures

Introduction

Method

Population study

DNA extraction

Genotype analysis

Statistical analysis

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1