Patients and materials
Between February 2016 and April 2018, chronic HBV carriers who were positive for serum hepatitis B surface antigen (HBsAg) on two occasions at least 6 months apart were recruited at Japan's Yokohama Eastern Hospital and Toho Sakura Medical Center. Seventy-one patients with chronic HBV infection alone (22 males, 49 females) were enrolled in this study. The majority of the patients were female because we have been following up HBV carrier mothers as well as children infected with HBV. The patients' median age was 18 years (range 1–56 years).
We also recruited patients with chronic HBV/HDV dual infections who were positive for serum HBsAg and anti-HDV IgG antibodies on two occasions at least 6 months apart at the National Center for Communicable Disease in Mongolia. These seven males and eight females ranged in age from 31 years to 63 years old (median 43 years). As negative controls, 15 subjects who were negative for serum HBsAg, anti-HBs, and anti-HBc were enrolled in this study. Samples of the patients' serum, fingernail (using a stainless steel clipper) and hair were collected by picking up at our hospitals. In order to avoid contamination, all of the nail and hair samples were washed three times with 1 mL of phosphate-buffered saline (PBS) each time and dried before being used in assays. The study protocols were approved by the ethical committee of Toho University Sakura Medical Center (no. 2015-073) and Eastern Yokohama Hospital (no. 2015010). This study was performed in accordance with the ethical guidelines of the 1975 Declaration of Helsinki. Written informed consent was obtained from all patients or legal guardians prior to sample collection.
HBV DNA, HBV RNA, and HDV RNA extraction
From each patient, 0.5–1.0 mg of fingernails (nail plate) in weight and five 1-cm pieces of hair in length were used for DNA/RNA extraction for the quantification of HBV DNA, HBV RNA, and HDV RNA. Hair with root was chosen for the extraction. Nail and hair DNA was extracted using the DNA Extractor FM kit (Wako Pure Chemical Industries, Osaka, Japan). The DNA extracted from nail and hair samples was dissolved in 50 µL of TE (Tris + EDTA) buffer. For the quantification of time-dependent nail HBV DNA, nails were incubated in 5 mL of recombinant cell dissociation reagent (TrypLE Select Enzyme 10X; Thermo Fisher Scientific, Waltham, MA). Then, nail HBV DNA was extracted from 200 µL of the cell dissociation reagent using a QIAamp DNA Blood Mini kit (Qiagen, Hilden, Germany). Serum HBV DNA was also extracted from 200 µL of serum using the QIAamp DNA Blood Mini kit (Qiagen). Finally, the extracted nail HBV DNA from the cell dissociation reagent and serum HBV DNA was dissolved in 100 µL of elution buffer.
For the extraction of HBV RNA from nails, the nail samples were resolved in 200 µL of the resolution buffer using DNA Extractor FM kit. The buffer containing resolved nail was then applied to an RNA extraction kit (Direct-zol RNA Mini Prep, Zymo Research, Irvine, CA). The RNA extracted from nail was dissolved in 50 µL of elution buffer. For the extraction of HDV RNA from nails, the recombinant cell dissociation reagent (TrypLE Select Enzyme 10X) was used. A small piece of nail (1–2 mm ´ 3–4 mm) was put into the tube containing 200 µL of the cell dissociation reagent and incubated at 37°C overnight. Of the 200 µL of dissociation agent, 140 µL was applied to the QIAamp Viral RNA Mini kit (Qiagen). The RNA extracted from the nail was dissolved in 60 µL of elution buffer. The extracted RNA was treated with DNase. Isolated HBV RNA was reverse transcribed with the random sequence anchored HBV specific primer. The sequence of the HBV specific primer for reverse transcription was 5'-ATTCTCAGACCGTAGCACACGACACGGAAAGAAGTCAGAAGGCAA-3', in which the random sequence ATTCTCAGACCGTAGCACACGACAC was anchored at the 5' end of the HBV-specific sequence GGAAAGAAGTCAGAAGGCAA (nucleotide [nt] 1974–1955) [20-22].HDV RNA was reverse transcribed with random hexamer. The nt position of the HBV sequence was based on the genotype C gene (GenBank accession no. AB033550).
Quantification of HBV DNA, HBV RNA, HDV RNA, and covalently closed circular DNA
Serum HBV DNA was measured by the COBAS TaqMan HBV DNA test ver. 2.0 (Roche Diagnostics, Tokyo). An in-house real-time assay was used for the quantification of HBV DNA from nail and hair samples [23]. The in-house PCR assay was standardized using HBV DNA samples of known concentrations measured by the COBAS TaqMan HBV DNA test with a lower detection limit of 2.1 Log copies/mL and recombinant plasmid controls. The lower detection limit was <100 copies/mL. The conversion factor between HBV copies/mL and HBV IU/mL is considered to be 5.82 copies/IU. As an internal control for DNA extraction from nail and hair, β-actin was also amplified by real-time PCR [24]. The β-actin DNA was quantified using recombinant plasmid controls.
Moreover, HBV covalently closed circular DNA (cccDNA), which accumulates cell nuclei and acts a template for the transcription of HBV viral genes, was quantified by real-time PCR [25]. For the quantification of cccDNA, DNA samples were incubated with T5 exonuclease (New England Biolabs, Ipswich, MA) to digest genomic DNA and viral relaxed circle DNA [26]. The recombinant plasmid controls were used for the quantification of cccDNA (Integrated DNA Technologies). The lower detection limit of the cccDNA assay was <1,000 copies/mL. Serum HDV RNA was measured by Fluorion HDV QLP 1.0 (Iontek, Istanbul, Turkey) with a lower detection limit of <3,500 IU/mL. The in-house real-time PCR assay for the quantification of nail HBV RNA and HDV RNA was based on the reported method [20-22, 27]. As an internal control for the HBV RNA extraction from nail, mRNA of GAPDH was also amplified by real-time PCR.
In brief, cDNA from HBV RNA was amplified with forward primer (HBV-PG-F) [5`-CACCTCTGCCTAATCATC-3’](nt:1826-1843), reverse primer (random sequence) [5’-ATTCTCAGACCGTAGCACACGACAC-3’], and TaqMan probe (HBV-FM) [5′-FAM-TCCAAGCTGTGCCTT-MGB-3’] (nt: 1871-1885) [20-22]. The primers and probe for the real-time PCR of nail HDV RNA were same as the reported method [27]. As an internal control for HBV RNA extraction from nail, mRNA of GAPDH was also amplified by real-time PCR (forward primer, 5'-CCTCCCGCTTCGCTCTCT -3', reverse primer: 5'-GCTGGCGACGCA AAAGA-3', probe: 5'-FAM-CCTCCTGTTCGACAGTCAGCCGC-3'-TAMRA).
Transcripts for use as the positive control for the HBV RNA and HDV RNA PCR assays were generated using a synthetic gene. We designed a synthetic gene containing the T7 promoter, forward and reverse sequence (Integrated DNA Technologies). The following synthetic sequence was used to generate the positive control for the HBV specific real-time PCR assay: TAATACGACTCACTATAGGGtttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtgtcgtgtgctacggtctgagaat (the length of the synthetic sequence was 199 bp. The use of italics indicates the T7 promotor sequence. The underlining indicates the HBV forward and reverse random sequence) and the HDV specific real-time PCR assay: TAATACGACTCACTATAGGGtggctctcccttagccatccgagtggacgtgcgtcctccttcggatgcccaggtcggaccgcgaggaggtggagatgccatgccgacccgaagaggaaagaagga (the length of the synthetic sequence was 125 bp. The use of italics indicates the T7 promotor sequence. The underlining indicates the HDV forward and reverse primer sequence). Transcripts were generated using the CUGA in vitro Transcription Kit (Nippon Gene, Tokyo) and then purified.
The transcripts were measured by a spectrophotometer, and the transcript copy number was calculated. The estimated transcript copy numbers of HBV RNA and HDV RNA were 1.16 ´ 1014 copies/mL and 1.29 ´ 1014 copies/mL, respectively. The lower detection limit of the HBV RNA and HDV RNA assay was <1,000 copies/mL. The real-time PCR was performed in a 25-μL reaction mixture containing 12.5 μL Premix Ex Taq (TaKaRa-Bio) with 0.4 μM of primers, 0.2 μM pf probes, and 3 μL of extracted DNA or cDNA. The real-time PCR program consisted of an initial pre-cycle incubation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. The PCR was performed in an MX3000P QPCR System (Agilent Technologies, Tokyo), and the results were analyzed with MxPro software (ver. 4.10). All assays were carried out in triplicate with negative control samples.
Quantification of HBsAg in fingernails
To elute HBV proteins from nails, we used the recombinant cell dissociation reagent (TrypLE Select Enzyme 10X). A small piece of nail (1–2 mm ´ 3–4 mm) was put into a tube containing 300 µL of the cell dissociation reagent and incubated at 37°C for 5 days. The reagent was then applied to the quantification of HBsAg. The HBsAg of fingernails was quantified using the high-sensitivity HBsAg chemiluminescent enzyme immunoassay Lumipulse HBsAg-HQ (Fujirebio, Tokyo, Japan). This assay measures the concentrations of HBsAg within the range 0.005–150 IU/mL.
HBV and HDV full-length genome sequencing and phylogenetic analysis
To confirm whether nails and hair are useful to identify the infectious source of HBV infection, we retrospectively analyzed the cases of patients with chronic HBV infection through mother-to-child transmission. Of the 72 patients, four children (nos. 18,.19, 23 and 41) were evaluated for the phylogenetic tree analysis of HBV complete genome sequence. We also analyzed serum samples from all four mothers and nail samples from two mothers (no. 18 and no. 41). Thus, a total of 18 samples (serum: n=8, nail: n=6, hair: n=4) were used for the analysis of the complete genome sequence of HBV. Moreover, the two HDV complete genome sequences were determined using nail HDV RNA from two patients (nos. HDV-6 and HDV-14). The complete genome sequences of HBV and HDV were amplified by the overlapping fragments method [28]. Similar to the HBV sequencing, the HDV compete genome was divided into the six overlapping regions. A nested PCR was performed to amplify the six regions [29]. The nested PCR primers are shown in Supplementary data Table S1. The nucleotide positions of the primer sequences were based on the HDV complete genome (GenBank accession no. KF660600). The PCR was performed using a 50-μL reaction mixture containing 25 μL of AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific), 0.4 μM of each primer, and 5 μL of cDNA. The first round of PCR amplification was performed as follows: initial pre-cycle incubation 95°C for 10 min, 40 cycles of denaturation at 95°C for 30 sec, annealing at 50°C for 30 sec, and extension at 72°C for 30 sec. Then, 2 μL of the first PCR reaction product was re-amplified with inner primers for 40 cycles under the same reaction conditions as in the first-round PCR.
The purified PCR products were then directly sequenced by cycle sequencing. The DNA sequences were aligned by using both the Genetyx software program (ver. 11; Software Development Co., Tokyo) and ClustalW software ver. 2.1 and were then compared with 46 published HBV DNA sequences and 51 published HDV RNA sequences. The phylogenetic tree was constructed by the neighbor-joining method [30], with pairwise distances being estimated by the Kimura two-parameter method. The reliability of the phylogenetic tree thus obtained was assessed with 1,000 bootstrap replicates [31]. The evolutionary distances were computed using the Maximum Composite Likelihood method [32]. These analyzes were performed with the MEGA 7.0.21 software program (http://www.megasoftware.net/) [33]. The nucleotide sequence data reported in this paper appear in the DDBJ/EMBL/GenBank nucleotide sequence databases with the accession numbers LC279245-62 (HBV), and LC426721-2 (HDV).
Immunohistochemical staining for fingernail samples
Formalin-fixed paraffin-embedded sections of fingernail were deparaffinized with xylene. The primary antibody for the detection of HBsAg and hepatitis D (HD) antigen in the fingernail was mouse anti-HBsAg monoclonal antibody (sc-57785, Santa Cruz Biotechnology, Santa Cruz, CA) at the concentration of 2 µL/mL and mouse anti-HDV monoclonal antibody (MC406.3, Gentaur Molecular Products, Brussels, Belgium) at the concentration of 10 µL/mL, respectively. Mouse anti-HBcAg monoclonal antibody (ab8638, Abcam, Cambridge, UK) and rabbit anti-SLC10A1 polyclonal antibody (ab131084, Abcam) were used as the primary antibodies for the detection of HBcAg and NTCP, respectively. As a negative control for the primary antibodies, mouse IgG1 (X0931, Dako, Glostrup, Denmark) was used. Biotin-labeled goat anti-mouse IgG (BA-9200, Vector Laboratories) was used as the secondary antibody.
Inoculation of chimeric mice and the real-time PCR for the mouse samples
Three female chimeric mice with humanized liver were purchased from Phoenix Bio (Hiroshima, Japan). The data of the three chimeric mice (Nos. 101, 201, and 202) on the first day of inoculation were as follows: body weight, 21.4, 21.7 and 21.5 g; serum human-albumin levels; 10.9, 12.0, and 11.7 mg/mL. Of the three mice, one (no. 101) was intravenously once inoculated with the negative control. The other two mice (Nos. 201 and 202) were intravenously inoculated once with supernatant of PBS incubated with fingernail. After the inoculations, blood samples for the real-time PCR assay were taken from the chimeric mice every week. A 50-µL sample of whole blood was taken from each mouse every week after the inoculation, and the sera were separated.
HBV DNA was extracted from 20 µL of mouse serum using the QIAamp DNA Blood Mini kit (Qiagen). The HBV DNA of the mouse serum was quantitatively measured using the in-house real-time PCR assay [23]. The lower detection limit was <1,000 copies/mL. These chimeric mice were kept in a clean room and supplied with sterilized laboratory chow and water. The mice were anesthetized with isoflurane and sacrificed. All animal experiments were performed in accordance with both the Guidelines for Animal Experimentation of the Japanese Association for Laboratory Animal Science and the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, and under the approval of the Ethics Review Committee for Animal Experimentation of Phoenix Bio (No.1853).
Statistical analyses
Categorical variables were compared between groups using the Yates corrected chi-square test or Fisher's exact test. Non-categorical variables were compared between groups by the Mann-Whitney U-test. For the correlations between two variables, we used Spearman rank-order correlation coefficient. All tests were two-sided, and p-values <0.05 were considered significant. All statistical analyses were performed with StatMate IV for Windows (Advanced Technology for Medicine & Science, Tokyo) and Microsoft Office Excel 2007.