Patients
Blood samples (n = 20) were obtained from CHC patients who were taking DAAs. All patients achieved a sustained viral response at 12 weeks (SVR12), and blood samples were again collected at 12 weeks after the treatment. Liver biopsy specimens were obtained from 14 of the 20 patients. Clinical data were obtained from their electronic clinical records. For healthy controls, blood samples (n = 15) were donated from healthy volunteers (HV) who served as hospital officers and did not display any abnormalities in their annual health check, including blood examination. The liver stiffness measurement (LSM) was performed using a FibroScan 502 (Echosens, Waltham, MA, USA), and Virtual Touch Quantification (VTQ) by acoustic radiation force impulse was performed using an ACUSON S3000 ultrasound system (Siemens, Erlangen, Germany).
Animals and treatments
Male wild-type BALB/c mice (wild-type) aged 8 weeks were obtained from Japan SLC (Shizuoka, Japan). The mice were bred in specific pathogen free condition (12 hours light/dark cycle, free access to water (automatic water supply) and food (CE-2, CLEA Japan, Tokyo, Japan)). The animals were intraperitoneally injected with 1 mL/kg body weight CCl4 (1:10 v/v in corn oil) (Sigma-Aldrich, St. Louis, MO, USA) twice a week for 2 weeks from 9 weeks of age in home cages (n = 4). In addition, the animals were administered 750 µg/mouse sorafenib tosylate (CS-0164; Chem Scene, Monmouth Junction, NJ, USA) dissolved in 200 µL 0.5% carboxylmethylcellulose via oral gavage 3 times a week for 2 weeks as needed (n = 4). Control animals were intraperitoneally administrated with corn oil (n = 4). After anesthesia by intraperitoneal injection with medetomidine, midazolam, and butorphanol tartrate, the animals were humanely killed by exsanguination 3 days after the final CCl4 treatment. The liver was immediately removed, and a section of the dissected tissue was frozen in liquid nitrogen. A part of the tissues was fixed with 10% formalin or embedded in optimal cutting temperature compound (Sakura Finetek Japan, Tokyo, Japan) for histological analysis. Based on our previous data that hydroxyproline is increased by CCl4 and that sorafenib reduces liver fibrosis in other mouse models, the sample size was determined (n = 4 in each group). The animals were randomly allocated to the groups. The experiment was performed as a single set and all animals were analyzed.
Enzyme-linked immunosorbent assay (ELISA)
ANGP-2 and ET-1 levels in the plasma were determined by ELISA (Human Angiopoietin-2 and Endothelin-1 Quantikine ELISA kits; R&D Systems, Minneapolis, MN, USA).
Histological analysis
The liver was fixed with 10% formalin, paraffine embedded, sectioned, and stained with hematoxylin and eosin (H&E). Collagen deposition was stained with Sirius Red (saturated picric acid containing 0.1% DirectRed 80 and 0.1% FastGreen FCF; Sigma-Aldrich). CD31 was stained in human samples with the anti-CD31 antibody (11265-1-AP; Proteintech, Rosemont, IL, USA) and EnVision + Dual Link System (DAKO, Carpinteria, CA, USA). Diaminobenzidine tetrahydrochloride was used as the peroxidase substrate, and the sections were counterstained with hematoxylin. For immunostaining of CD31, CD146, and ANGP-2, 5-µm-thick frozen liver sections were cut on a cryostat, fixed with methanol/acetone, and stained with the following specific antibodies: fluorescein isothiocyanate (FITC)-conjugated CD31 (11-0311-81; Invitrogen, Carlsbad, CA, USA), phycoerythrin (PE)-conjugated CD146 (134704; BioLegend, San Diego, CA, USA), and ANGP-2 (ab155106; Abcam, Cambridge, UK). Alexa Fluor 546-conjugated anti-rabbit IgG (A11035; Invitrogen) was used as the secondary antibody. The nuclei were stained with mithramycin and 4’-6-diamindino-2-ohenylindole. The Sirius Red-positive area or CD31-positive area of the liver specimens was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA) and shown as a percentage of the total section area. The specimens were observed using a microscope (Z9000; Keyence, Osaka, Japan).
Hydroxyproline measurement
Liver tissue was homogenized and hydrolyzed for 24 h at 110 °C in 6 N HCl. The samples were oxidized with chloramine-T (Sigma-Aldrich) and incubated in Ehrlich’s perchloric acid solution. The sample absorbance was measured at 558 nm. Purified hydroxyproline (Sigma-Aldrich) was used as the standard. Hydroxyproline content was expressed as µg hydroxyproline/g liver.
Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)
A High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) was used for reverse transcription. Real-time qRT-PCR was performed using SYBR Premix Ex Taq (Takara, Shiga, Japan) for ANGP-2 (TCCAAGAGCTCGGTTGCTAT and AGTTGGGGAAGGTCAGTGTG), CD146 (CCCAAACTGGTGTGCGTCTT and GGAAAATCAGTATCTGCCTCTCC), ANGP-1 (TGCAGCAACCAGCGCCGAAA and CAGGGCAGTTCCCGTCGTGT), VEGFA (AAAGGCTTCAGTGTGGTCTGAGAG and GGTTGGAACCGGCATCTTTATC), and ET-1 (TTCCCGTGATCTTCTCTCTGC and CTGCACTCCATTCTCAGCTCC) as well as the probe and primer sets (Applied Biosystems) for 18S rRNA (Hs99999901s1) with the Thunderbird Probe qPCR mix (Toyobo, Tokyo, Japan). PCR was performed on a LightCycler 480 (Roche Applied Science, Mannheim, Germany). The measured changes were normalized based on 18S rRNA values.
Alanine transaminase (ALT) measurements
Plasma ALT levels were measured using SPOTCHEM D (Arkray, Kyoto, Japan).
Statistical analysis
The results are expressed as the means ± standard deviations (SDs) of data collected from at least three independent experiments. The data were compared between groups using a one-way analysis of variance (ANOVA), the Kruskal-Wallis test, or the two-tailed Student’s t-test. Pearson’s or Spearman’s rank correlation coefficients were used for correlation analysis. P < 0.05 was considered statistically significant. Statistical analyses were performed using GraphPad Prism software version 5 (GraphPad Software Inc., San Diego, CA, USA).