Materials
LBP of 95% purity was purchased from Shanghai Biological Co. The LBP was dissolved in ultrapure water and stored at 4 °C. All analytical reagents were used directly without further purification. Fresh stock solutions were prepared after 15 days.
Cell Culture
All animal experimental procedures were performed at Ningxia University. The study was approved by the animal ethics committee of Ningxia University (2020-3-24). Sixty (60) Balb/c mice (6 weeks old, female) were purchased from the Shanghai Laboratory Animal Center of the Chinese Academy of Sciences. The animals were housed in a controlled temperature environment. Animals were maintained in cages in an air-conditioned animal room with a constant temperature of 21°C and with 12:12-hour dark-light cycle. Animals had free access to drinking water and to the standard laboratory diet. Just before tissue sampling, animals were killed by decapitation using a laboratory guillotine. We developed the mice airway epithelia's primary culture at the air-liquid interface (ALI)[12, 13]. Ten percent (10%) FBS was added to the culture and finally converged to terminate enzymatic dissociation. Subsequently, the culture was placed in a centrifuge for 10 min at 4℃ to collect 500 g epithelial cells. The cells were resuspended in DMEM 10% FBS culture, and the cells on the tissue culture plate incubate the fibroblasts in 5% CO2 for 2-4 h at 37°C. 500 g of non-disciple cells were centrifuged at 4℃ for 10 min, and the cells in the bronchial epithelial cell growth medium were collected. We used an automated vision-based cell counter to determine the total number of cells. P. aeruginosa was used to infect the 6-week ALI cultures. Cells were infected on the culture model's apical surface for 20 min at a 30-fold multiplicity infection rate. Culture medium containing uncultured P. aeruginosa were removed from the top of the culture. P. aeruginosa was cocultured with epithelial cells for 36 h, and the cells were collected after coculture. The morphology of the cells and bacterial colonization were observed by hematoxylin-eosin staining. All staining reagents were obtained from Sigma-Aldrich (Missouri, U.S.A.). We observed mice bronchial epithelial cells' characteristics by utilizing immunofluorescent staining of tubulin4, keratin14. PAS staining was used to detect glycogen secretion in cells. Tubulin 4, keratin 14, and PAS staining were assessed in mice bronchial epithelial cells.
Identification of cells surface marking molecules and immunofluorescent staining
The cells were fixed with 4% paraformaldehyde for 15 min at room temperature. The fixed cells were washed with PBS 3 times and then permeabilized with 0.3% Triton X-100 for 20 min. Further, the cells were blocked in 5% ordinary goat serum for 1–2 h at room temperature. Rabbit antikeratin 14 and PAS antibodies (Thermo, Rockford, USA) and rabbit anti-P. aeruginosa (home-made antibody; 1:200) were added to the cells and incubated overnight at 4°C. After removing the primary antibody, the cells were washed 3 times with PBS. Alexa Fluor 594 labeled antibody (green) and Alexa Fluor 594 labeled antibody (red; Jackson Immuno Research Laboratories, West Grove, PA, USA; 1:500) were added to the cells as fluorescent secondary antibodies to detect primary antibodies. The fluorescent secondary antibodies were removed and washed 3 times with PBS, and the membrane was fixed on a glass slide by Vectashield Mounting Medium (H-1200, Vector Laboratories, Burlingame, CA) with DAPI. Colocalization images were acquired by the Leica TCS SP2 A0BS confocal system and analyzed by Leica Confocal Software v. 2.6.1 (Leica, Germany).
Cell viability assay
The ALI cultured bronchial epithelial cells were plated in 96-well plates at a concentration of 5 x 103 cells/well. ALI cultured bronchial epithelial cells were incubated with 5% CO2 at 37˚C for 2h. The PCN treated group was subsequently treated with a gradient concentration of PCN at the time points 6 h, 12 h, and 24 h, respectively. The LBP pretreated group was pretreated with LBP at gradient concentration for 2 h before adding PCN. Cell activity was detected by the MTT method according to the kit instructions. Briefly, 20 μL MTT (5 mg/ml; Sigma-Aldrich, Saint Louis, MO) was added to the previous section’s processing groups. The MTT-added medium and the cells were incubated at 37°C for 4 h. The plate was read at 570 nm using a microplate reader (Model 680; Bio-Rad Laboratories Inc, Hercules, CA) according to the reference wavelength. Untreated cells were used as controls, and the wells with PBS served as blank control wells. The average optical density (OD) was subtracted from the OD of the sample compared with the control cells' OD. We used the following formula to calculate the percentage of cell viability: average density (OD) of the treated group − blank/mean OD of control cells × 100%.
Western blot
Cells were lysed in a cell lysis buffer to obtain the total cellular extracts. Pierce BCA Protein Assay Kit was employed to determine the content of total protein in lysis cellular extracts[14]. The sample protein was separated using 10% SDS-PAGE, and BCA quantified the protein sample concentration. Finally, the amount used in 10% SDS-PAGE was 20 μg. A nitrocellulose membrane (Mini-PROTEAN Tetra Cell, Bio Rad, Hercules, CA) was used to blot the SDS-PAGE. The HRP-conjugated secondary Ab or FLA9000 (Fuji Film, Minato, Japan) protein was visualized by ECL using ChemiDoc-It (UVP, Upland, CA). The strip densitometry was performed in ImageJ Freeware (http://rsbweb.nih.gov/ij/). Antibodies used for blotting were Bcl-xl, 1:1000; Bcl-2, 1:500; Caspase-3, 1:1000; Caspase-9, 1:500 (Proteintech Group, U.S.A.); Cytochrome C, 1:1000 (Abcam, U.K.), and PARP-1, 1:500 (Cell Signal, U.S.A.).
Real-time quantitative Polymerase Chain Reaction (PCR) analysis
The total RNA from mouse bronchial epithelial cells was isolated using TRIzol® reagent. Then the sample was reverse transcribed from RNA to cDNA using a Prime Script RT kit. Polymerase Chain Reaction (PCR) amplification was performed on the ABI 7500 Fast Thermal Cycler (Applied Biosystems, USA) according to the SYBR Green PCR Kit (Takara Biotechnology Co., Ltd., Dalian, China). PCR cycle was conducted for 30s at 95°C, followed by 40 cycles at 95°C for 5s and an annealing/extension step at 60°C for 15s. The primer was designed by the Shanghai Sango Company (Shanghai, China). The specific primers are shown in Table 1.
Table 1
qRT-PCR primer sequences
Gene
|
Forward (5’-3’)
|
Reverse (5’-3’)
|
Caspase3
|
GGTGCCTATGTCTCAGCCTCTT
|
GCCATAGAACTGATGAGAGGGAG
|
p62
|
TGGACCTTCCAGGATGAGGACA
|
GTTCATCTCGGAGCCTGTAGTG
|
Beclin-1
|
TACCACTTCACAAGTCGGAGGC
|
CTGCAAGTGCATCATCGTTGTTC
|
PARP
|
GACAGCCTGTGTTCGAGGATATG
|
TGTTCTTACAGGAGAGGGTAGAC
|
BAD
|
CATCACTGCCACCCAGAAGACTG
|
ATGCCAGTGAGCTTCCCGTTCAG
|
mTOR
|
TGAAAACACAGAAGTAACGTCCG
|
CCCAGGAGGAAATTGTAATGGGA
|
TGF-β
|
CTGGACTCATCGCAAACACAA
|
AGGAAGCCTTTGACTTCTGTCTA
|
NF-κB
|
AGATACTGCAAAGGATGCTCAAA
|
CAGCCTGATGGAATCATGGTC
|
Bcl-2
|
CCCATCTTTGAGCATCTTGGT
|
GCCCAGCCTGAGTAGTGAAG
|
Bcl-xl
|
CATCTTGGTTTCAAGCCCAGA
|
CTGCCCAGGCCAAAATTGC
|
β-actin
|
TTTGTTACCAGGCTCTCTTCC
|
GAATTGGGGCTTAGGCATCCA
|
Measurement of intracellular reactive oxygen species (ROS)
The ALI cultured bronchial epithelial cells were plated in 96-well plates at a concentration of 5 x 103 cells/well. PCN (50 µM) was added to the bronchial epithelial cells and incubated with PCN at 5% CO2 atmosphere at 37˚C for 24 h after LBP treatment for 2 h. Twenty-five μM DCFH-DA was added to the plate, and the treated cells were incubated with DCFH-DA at 37°C for 30 min. The fluorescence was measured using a Microplate Reader (BIO-TEK, INC). According to the kit instructions, excitation and emission were set to 485 nm and 535 nm, respectively. Immunofluorescence microscopy was used to capture the ROS reaction. The average level of ROS was measured using a ROS assay kit DCFH-DA (Beyotime Biotech, Nanjing, China). Approximately 3×105 cells/well were seeded in 6-well plates overnight, followed by PCN treatment with or without LBP pretreatment for 24 h. DCFH-DA was diluted to a final concentration of 10 μM. The cells were collected and suspended in diluted DCFH-DA in the dark at 37°C for 30 min and washed 3 times with PBS. The resulting samples were analyzed using an Accuri C6 Flow Cytometer (BD Biosciences, Franklin Lakes, NJ, USA).
Enzyme-linked immunosorbent assay
PCN (50 µM) was added to the mouse bronchial epithelial cells medium and incubated in a 5% CO2 atmosphere at 37˚C for 24 h. The above-mentioned PCN concentration (50 µM) was added to the cell cultures. The cells were incubated in a 5% CO2 in the atmosphere at 37˚C for 24 h after LBP treatment for 2 h. Subsequently, the culture supernatant for inflammatory factors detection were collected. According to the kit instructions, TNF, IL-6, and IL-8 concentration in the cell supernatant was also determined by enzyme-linked immunosorbent assay (ELISA).
Histopathology and immunohistochemistry evaluation.
The animals were randomly divided into 6 groups (n = 9). Group I animals were set as the blank control group and treated with 50 μL of physiological saline. Group II animals were set as the PCN treatment group and treated with 50 μg/50 μL PCN. Group III animals were set as the LBP treatment group and treated with LBP at a dosage of 3 mg/kg. Group IV animals were set as the P. aeruginosa treatment group and treated with PFU of 1×106 CFU. Group V animals were set as the PCN treatment group after LBP pretreatment, and the treatment conditions were as described above. The Group VI animals were set as the P. aeruginosa treatment group after LBP pretreatment, and the treatment conditions were as described above. All the above treatments were imposed on the mice by intranasal route for 7 days. According to the aforementioned groups, for 7 days, the mice were sacrificed by cervical dislocation after treatment imposition. The mice were dissected after simple disinfection, and the lung and spleen tissues were collected for further morphological analysis. The lung and spleen sections were blocked at room temperature using saline containing 0.1% BSA. The sections were gently incubated for 2 h using the following primary antibodies: Bcl-2 (Abcam), Caspase-3 (NIMP-R14, Abcam), and Cyt-c (NB600-404, Novus Biologicals). Further, we removed the primary antibodies, thoroughly washed the membranes with 0.5% TBS-Tween 20, and subsequently incubated and shook them gently for 2 h after adding a biotinylated secondary antibody. At least 5 slices per organism were manufactured for each treatment group. We captured images at 200× or 400× using the Zeiss microscope and ZEN software.
Statistical analysis
All data collected were obtained from at least three independent experiments for each condition. GraphPad Prism version 7.0 (GraphPad Prism Software Inc., La Jolla) was used for data analysis and graphic images. Statistical evaluation of the data was performed using a t-test to compare differences between the treatment groups. The difference was statistically significant (*: p <0.05;**:p<0.01;***:p<0.001).