Cell culture
CCC-HPF-1 cells (3111C0001CCC000107) and Chang liver cells (3131C0001000200009) were obtained from National Infrastructure of Cell Line Resource. CCC-HPF-1 cells were maintained in DMEM with 20% FBS and Chang liver cells were cultured in RPMI 1640 with 10% FBS. HCT116 cells were the gift from Dr. Hui Zhang (Department of Chemistry and Biochemistry, University of Nevada, Las Vegas, Nevada 89154, USA), and cultured in DMEM supplemented with 10% FBS. Cells were authenticated by Shanghai Biowing Biotechnology Co.LTD, and Mycoplasma were tested after cells were cultured for one weeks using GMyc-PCR Mycoplasma Test Kit (Yeasen Biotech Co. Ltd, Shanghai, China). Cells used for experiments were maintained for one month. Immunostaining was performed as previously described [37].
Antibodies
Anti-CDT1 (A300-786A), CDT2 (A300-947A), MCM2 (A300-191A) and MCM3 (A300-192A) antibodies were purchased from Bethyl Laboratories Inc. Anti-Histone H3 antibody (ab1791) was from Abcam, and anti-Flag antibody (F1804-200UG) was from Sigma-aldrich. Anti-GAPDH (60004-1-Ig), HA (66006-2-Ig), p21 (10355-1-AP) and SET8 (14063-1-AP) antibodies were purchased from Proteintech. Anti-PCNA (sc-56) and MCM7 (sc-9966) antibodies were purchased from Santa Cruz Biotechnologies. Anti-DDB2 (PA5-79143 and PA5-63568) antibodies were from Invitrogen. Homemade polyclonal antibodies of CDT2 and CUL 1 were gifts from Dr. Hui Zhang (Department of Chemistry and Biochemistry, University of Nevada, Las Vegas, Nevada 89154, USA).
Chromatin binding proteins isolation
HCT116 cells were trypsinized, washed with PBS and lysed in buffer A (10mM Hepes pH 7.9, 10mM KCl, 1.5mM MgCl2, 0.34M sucrose, 10% glycerol, 0.1% Triton X-100 and protein inhibitors) on ice for 15 minutes, and centrifuged for 5 minutes at 2000g. The supernatant was collected as soluble fraction. The precipitation was re-suspended in buffer B (3mM EDTA, 0.2mM EGTA, and protein inhibitors). After centrifuged for 5 minutes at 2000g, the precipitation was digested by micrococcal nuclease in digestion buffer (0.32M sucrose, 50mM Tris-Cl pH7.5, 4mM MgCl2 and 0.1mM PMSF) for 10 minutes at 37℃. After centrifuged for 10 minutes at 8000g, the supernatant was collected as the chromatin binding proteins fraction.
Total RNA isolation and real-time PCR
Cells were harvested with RNAiso Plus (#9109, Takara Biotechnology Co. Ltd., Dalian) and total RNA was isolated according to manufacture. Reverse transcription was performed using Reverse Transcriptase M-MLV (RNase H-) (#2641A, Takara Biotechnology Co. Ltd., Dalian). The relative mRNA levels of target genes were quantified by SYBR Fast qPCR Mix (#RR430S, Takara Biotechnology Co. Ltd., Dalian) in a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). GAPDH was taken for normalization. The primers used for real-time PCR were as following: DDB2 forward: GCTGAACATGGACGGCAAAG and DDB2 reverse: CCATCGGGACTGAAACAAGC; CDT2-1 forward: CGTCTCCTATCAGTCCGTAT and CDT2-1 reverse: GGATTCTCAGCCTTCCGTTT; CDT2-2 forward: CGTCTCCTATCAGTCCGTAT and CDT2-2 reverse: TGTCTTTCCGCTCTGTCTCC; CDT1 forward: GTGCTGCGGAGCGTCTTTGT and CDT1 reverse: TGCAGTGATGTGGGCGAGGT; GAPDH forward: ACCACAGTCCATGCCATCA and GAPDH reverse: CAGGGATGATGTTCTGGAGA.
Co-immunoprecipitation (Co-IP) and in vivo ubiquitination
For protein co-IP, asynchronized HCT116 cells were suspended in IP buffer (0.5% Nonidet P40, 50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM EDTA, and proteinase inhibitors) on ice for 15 min and centrifuged at 15500 g for 15 min. The supernatant was incubated with indicated primary antibodies overnight at 4℃. After incubated with protein G beads for 2 hours at 4℃, the immunocomplexes were recovered, and suspended in SDS-sample buffer.
For in vivo ubiquitination, HCT116 cells were co-transfected with 2 μg plasmids expressing HA-tagged ubiquitin and Flag-DDB2 or vectors using polyetherimide. After transfected for 48 hours, cells were treated with 10 μg/mL MG132 for 4 hours and harvested for co-immunoprecipitation (0.5% Nonidet P40, 50 mM Hepes pH 7.5, 150 mM NaCl, 0.05% SDS, 1 mM EDTA, and proteinase inhibitors) using anti-CDT2 antibody and performed Western blot using anti- HA antibody.
Transfection and siRNAs
For transfection, HCT 116 cells were seeded in 6 well plate for 20 hours and transfected with indicated plasmids using polyetherimide. Forty-eight hours after transfection, cells were lysed with SDS-sample buffer and proteins were analyzed by Western blot.
Small interfering RNAs were designed and synthesized by GenePharma Company. The siRNA sequences were as following: luciferase: CGTACGCGGAATACTTCGA; CDT2: ACTCCTACGTTCTCTATTA; PCNA: GAUCGAGGAUGAAGAAGGA; DDB2-1: CTCCAGAGTTGGTGACACA; DDB2-2: GATGGAAACTCAGGGAAGA; DDB2-3: GAGCGAGAUCCGAGUUUAC.
For siRNA mediated silencing, HCT116 cells were transfected with 50 nM siRNAs for 48 hours using DharmaFECT Transfection Reagent (#T-2001-03, Thermo Fisher Scientific Inc.) according to manufacturer’s instructions, and cell lysate was analyzed by Western blot.
Cell synchronization and Flow cytometry analysis
Cell synchronization was performed as described. G1/S arrest was achieved by double thymidine (2.5mM) treatment (16 hours treament-12 hours release-16 hours treatment). S phase was obtained from G1/S release for 4 hours. Small interfering RNA mediated silencing was performed 8 hours before thymidine was added.
For flow cytometry analysis, cells were fixed with ice-cold 70% ethanol for 2 hours at 4℃. After rinsed with PBS, cells were incubated in staining buffer (25μg/mL propidium iodide, 1% Trion X-100 and 50μg/mL RNAase) for 30 minutes at 37℃, and analyzed by FACS (Cytomis FC 500, Beckman Coulter). DNA contents were evaluated with FlowJo7.6.5.
Immunohistochemistry
Human ovarian teratoma tissue sections and breast cancer tissue sections were prepared by Shenzhen Second People’s Hospital, and proved by the Ethics Committee of Shenzhen Second People’s Hospital in accordance with the principles of the 1964 Helsinki declaration. Immunohistochemistry (IHC) was performed using horseradish peroxidase/3, 3′-diaminobenzidine (DAB) (ABC) detection IHC Kit (ab64261, abcam). Briefly, The slides were heated at 60℃ for 90min, deparaffinized in xylene, rehydrated with 100%, 90%, 80% and 70% ethanol, and immersed in methanol with 3% H2O2 (hydrogen peroxide) for 10min at room temperature to inactivate endogenous peroxidase. Antigens were heat-retrieved in sodium citrate buffer (10mM sodium citrate and 0.05% Tween 20, pH 6.0) at 100℃ for 8min. After blocked with 10% serum for 30min at 25℃, the slides were incubated with primary antibodies against CDT2 (dilution 1:150) and DDB2 (dilution 1:150) overnight at 4℃. Incubated with biotin-conjugated secondary antibody for 20min at 25℃, washed with PBS, and then incubated with streptavidin peroxidase for 15 minutes at room temperature, the sections were stained with DAB and counterstained in hematoxylin. After dehydration and coverslip, images were captured under microscope (Olympus IX73) using cellSens Dimension program.
Quantification and statistical analysis
To quantify and compare the protein band densities in the Western blots shown in the figures, the blots was quantified by Gel-Pro Analyzer (version4.0, Media Cybernetics, Inc.), which is the software for area density analyzation. The band density of each protein in various samples was normalized to loading controls.
All experiments were performed at least three times. Data were presented as mean ± SD. The mean was generated from triplicate experiments and SD was the standard deviation. Paired two-side Student’s t-test was performed to measure the significance of the difference between control group and experimental group, and p<0.05 was considered as significant. * Denotes p<0.05, ** denotes p<0.01, and *** denotes p<0.001. GraphPad Prism 5.0 was used to generate the plots.