Animals
Animals were housed in AAALAC-accredited facilities, and all experiments were conducted under protocols approved by the Creighton University Institutional Animal Care and Use Committee. C57BL/6J mice were obtained from The Jackson Laboratory. Mice were housed and bred in the animal care facility at Creighton University under a 12/12 h light/dark cycle with ad libitum access to food. For primary microglial and cortical neuronal cell isolation, animals were treated in strict accordance to the approved Institutional Animal Care and Use protocol #0793. For LPS injection In Vivo Model, animals were treated in strict accordance to approved by the Institutional Animal Care and Use Protocol #1086.
LPS Injection In Vivo Model
Male and female C57BL/6J mice of age 6-weeks old were divided into two groups: a vehicle control group receiving intravenous (IV) tail vein injection of Dulbecco’s phosphate-buffered saline (50 µl/10 g, DPBS, Thermo Fisher Scientific, Waltham, MA) or an experimental group receiving an IV injection of LPS at 1 mg/kg (Escherichia coli O111:B4, Sigma-Aldrich, St Louis, MO, USA) in DPBS. At 24 hours, mice were anesthetized with ketamine/xylazine and transcardially perfused with cold phosphate-buffered saline (PBS). Mice were weighed before LPS injection and 24 hours after injection. LPS injected mice usually lose ~ 10% of the body weight, which can be used as an indication of successful tail vein delivery of LPS. Brain tissue was dissected and immersed in Invitrogen RNALater™ (Thermo Fisher Scientific, Waltham, MA) overnight at 4 oC and stored at -80 oC for Invitrogen TRI Reagent™ (Thermo Fisher Scientific, Waltham, MA) RNA extraction. RT-PCR was performed as described below.
Microglial Cell Line Culture
BV2 mouse microglial were purchased from American Type Culture Collection (ATCC CRL-2467; Manassas, VA). BV2 cells were maintained in DMEM (Hyclone, ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS, Hyclone #SH30072.03, Lot No. AXB30110, Thermo Fischer Scientific, Waltham, MA), 1% l-glutamine, 1% penicillin/streptomycin (ThermoFisher Scientific, Waltham, MA). Cells were grown in 100-mm tissue culture dishes at 37 ºC in 5% CO2 and allowed to reach 80% confluency before passage.
Primary Cortical Microglial Cell Culture
Primary microglial cells were isolated from P0-P2 C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME). Use of animals was performed in strict accordance with the Institutional Animal Care and Use committee guidelines as approved by the IACUC committee at Creighton University (protocol #0793). P0-P2 mouse brains were dissected, meninges were removed, and cortices were isolated in ice cold, sterile Ca2+/Mg2+-free Hank’s balanced salt solution (HBSS, #14025092, Thermo Fischer Scientific, Waltham, MA). Cortices were minced and mechanically dissociated in Ca2+/Mg2+-free HBSS, with 0.035% sodium bicarbonate (#25080094, Thermo Fischer Scientific, Waltham, MA) and 1 mM pyruvate (pH 7.4, #11360070, Thermo Fischer Scientific, Waltham, MA) following 15 min digestion with 0.25% trypsin-EDTA (#15090046, Thermo Fischer Scientific, Waltham, MA). Trypsin was neutralized with Dulbecco’s Modified Eagles Media (DMEM, Hyclone, Thermofisher Scientific, Waltham, MA) supplemented with 10% FBS (Hyclone #SH30072.03, Lot No. AXB30110, Thermo Fischer Scientific, Waltham, MA) and cells were mechanically triturated. Cells suspension was strained through a sterile 70 µm nylon mesh strainer and plated onto poly-D-lysine coated 75 cm2 tissue culture flasks in DMEM plus 10% FBS and penicillin/streptomycin and allowed to reach confluency over 14 days at 37 ºC in 5% CO2. After reaching confluency cells were shook vigorously and on an orbital shaker at 220 rpm to remove microglia. Microglial were collected and re-seeded at 0.5 × 106 cells/ml onto tissue culture plates. After 1 h attachment, floating cells were removed and adherent cells were cultured in DMEM plus 10% FBS and penicillin/streptomycin at 37 ºC in 5% CO2. unless rinsed and switched into Neurobasal media for experiments. Microglial purity was determined using immunocytochemical analysis of cortical cell protein expression (described below).
Isolation of Cortical Neurons
Primary cortical cells were isolated from P0-P2 C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME) following methods modified from Ahlemeyer et al., 2005 (75). Use of animals was performed in strict accordance with the Institutional Animal Care and Use committee guidelines as approved at Creighton University (Protocol #0793). Briefly, P0-P2 mouse brains were dissected, meninges were removed, and cortices were isolated in ice cold, sterile Ca2+/Mg2+-free Hank’s balanced salt solution (HBSS, #14025092, Thermo Fischer Scientific, Waltham, MA). Cortices were minced and mechanically dissociated in Ca2+/Mg2+-free HBSS, with 0.035% sodium bicarbonate (#25080094, Thermo Fischer Scientific, Waltham, MA) and 1 mM pyruvate (pH 7.4, #11360070, Thermo Fischer Scientific, Waltham, MA) followed by 15 min digestion with 0.25% trypsin-EDTA (#15090046, Thermo Fischer Scientific, Waltham, MA). Trypsin was neutralized with Dulbecco’s Modified Eagles Media (DMEM, Hyclone, Thermofisher Scientific, Waltham, MA) supplemented with 10% FBS (Hyclone #SH30072.03, Lot No. AXB30110, Thermo Fischer Scientific, Waltham, MA). The cell suspension was washed three times and resuspended with Neurobasal media supplemented with B-27™ Plus Supplement (GibcoBRL #A35828-01, Thermo Fischer Scientific, Waltham, MA) and penicillin/streptomycin (#10378016, Thermofisher Scientific, Waltham, MA) and dissociated with mechanical trituration. Cells suspension was centrifuged for 5 min at 1000 rpm, resuspended in supplemented serum-free Neurobasal media and plated onto poly-D-lysine (#P0899, Sigma, St. Louis, MO) coated tissue culture plates at density of 1.5 × 106 cells/well in 6-well plates and 5 × 105 cells/well in 24-well plates at 37 ºC in 5% CO2 for at least one week. Each cortical culture was considered a biological replicate and all experiments were performed in triplicate.
Neuronal – Microglial Co-Cultures
BV2 microglia and neuronal cells were cultured as described above. BV2 microglia were pre-seeded directly onto 6-well permeable Transwells® onto 24-well, 0.4 µm Transwells® at 4 × 104 cells/well (Corning,Tewksbury, MA) and cultured for 24 hours in Neurobasal serum-free B27-free media before being suspended above cortical neurons in the co-culture model system (Fig. 7A, Created with BioRender.com). BV2 microglia were placed in suspension above cortical neurons and co-cultured for an additional three days in unsupplemented Neurobasal media at 37 ºC in 5% CO2. After co-culture, Transwells® with microglia were removed and cortical neuronal cultures were fixed in culture media plus 3.7% formaldehyde at 37 oC in 5% CO2. Cortical neuronal cultures were assessed using immunocytochemistry (described below).
Immunocytochemistry
Cortical primary microglial or cortical neuronal cultures were fixed with 3.7% formaldehyde in cell culture media, rinsed in PBS. Cells were permeabilized with 0.2% Triton X-100 in PBS for 10 minutes, washed, and blocked for 1 hour in PBS, 0.2% BSA, and 0.2% Triton X-100. Primary antibodies were applied and incubated overnight at 4 ºC in PBS, 0.2% BSA, 0.2% Triton X-100. Cells were incubated with anti-Iba-1 (microglial marker, Abcam, rabbit anti-GFAP (1:400, Millipore Cat# AB5541, RRID:AB_177521), and mouse anti-beta tubulin III/TUJI (1:200, Millipore Cat# MAB1637, RRID:AB_2210524). Secondary antibodies were applied for 1 h at a concentration of 1:500 for goat anti-rabbit IgG (H + L) Alexa Fluor 488 conjugate and goat anti-mouse IgG (H + L) Alexa Fluor 594 488 conjugate (Pierce, Rockford, IL). Nuclei were visualized using a DAPI stain (300 mmol, MP Biomedicals, Santa Ana, CA). Qualitative and quantitative analysis of immunocytochemistry was performed by acquiring images with a Leica DMI4000B inverted microscope with a cooled CCD camera (Q Imaging, Surrey, BC) and fluorescent capabilities. For quantification of the percent of cells expressing cell-specific proteins was determined by counting the number of immunopositive cells for each marker and dividing that number by the total number of cells counted in the field. For quantification of relative fluorescence intensity units associated with the immunocytochemistry experiments localizing protein expression in cortical cell cultures. In all experiments, images were analyzed with Volocity (PerkinElmer,USA) and ImageQuant (GE Healthcare, USA) software were used for image analysis and presentation. For image data, 3 field views of at least 100 cells from 3 separate experiments were analyzed for each condition.
Measurement of Cell Viability – propidium iodine incorporation
Cell viability was measured using propidium iodine incorporation methods as described by the manufacturer (Invitrogen, #P1304MP, Thermo Fischer Scientific, Waltham, MA). Propidium iodide will permeate dead cells and is used to detect cell death/viability. Briefly, following co-culture with microglia cortical neuronal cultures were RNase-Treated by equilibrating for 5 min in 2X SCC buffer (0.3M NaCl, 0.03M sodium citrate, pH 7.0) and then incubated in 100 µg/ml RNase-free RNase in 2X SCC for 20 min at 37 oC. Cells were rinsed three times in 2X SCC and counterstained with 500 nM PI in 2X SCC for 5 min. Cells were rinsed three times in 2X SCC, excess buffer was removed, placed in 1X PBS and imaged immediately. Neuronal cultures were viewed for propidium iodide (PI) red-fluorescent nuclear and chromosome counterstaining. Images were acquired via the EVOS M5000 cell imaging system (Excitation 535 nm/Emission 617 nm) and images saved for later analysis using Firmware, EVOS FLoid Software (Thermo Fischer Scientific, Waltham, MA). In all experiments, acquired images were analyzed with Volocity (PerkinElmer,USA) and ImageQuant (GE Healthcare, USA) software were used for image analysis and presentation. Experiments were performed in triplicate.
Small interfering RNAs and transfection
For gene silencing, the small interfering RNA (siRNA) duplexes for mouse Nostrill were synthesized using Integrated DNA Technologies. The siRNA sequences targeting Nostrill were as follows: sense, 5′- CGAGAUAGGCUGAGGACUU − 3′; antisense, 5′- AAGUCCUCAGCCUAUCUCG − 3′. The nonspecific scrambled siRNA sequence UUCUCCGAACGUGUCACGUUU was used for the control. Cells were treated with siRNAs (final concentration, 60 nM) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. For Nostrill overexpression, Nostrill cDNA was amplified through PCR, inserted into the PTarget (Promega, Madison, WI) expression vector to generate PTarget-Nostrill, and subsequently sequenced. According to the manufacturer’s protocol, cells were transfected with plasmid DNA using Lipofectamine 2000. Quantitative RT-PCR was used to determine the significant alteration of each target gene.
RT-PCR Analysis
For real-time PCR analysis of cytokines, total RNA was isolated from cells with Trizol reagent (Applied Biosystems). An amount of 200 ng total RNA was reverse-transcribed using the iScript Reverse Transcription Supermix (Bio-Rad, Hercules, CA). Comparative real-time PCR was performed using the Invitrogen™ SYBR GreenER™ qPCR SuperMix Universal (Thermo Fisher Scientific, Waltham, MA) on the Bio-Rad CFX96 Touch™ Real-Time PCR Detection System. The sequences for all the primers are listed in Supplementary Table 1. Normalization was performed using Gapdh. Relative expression was calculated using the comparative Ct (ΔΔCt) method.
Griess Analysis
Media collected from microglial cultures were evaluated using a Nitric Oxide Assay Kit to determine nitric oxide composition through measurement of nitrate (NO3) and nitrite (NO2) levels according to manufacturer’s instructions (#EMSNO, Thermo Fischer Scientific, Waltham, MA). Briefly, 1X reagent diluent, NADH, and nitrate reductase were prepared as recommended in the kit instructions. Samples were diluted 1:2 with 1X reagent diluent and filtered through a 10,000 MWCO filter. NADPH was oxidized with 10 µL of lactate dehydrogenase (1500 U/ml in 30 mM sodium pyruvate) after incubation with nitrate reductase and incubated at 37 oC for 10 min. Nitrate standards were prepared by serial dilution following manufacturer’s instructions. Griess reagent I and II were added to standard, control, and sample wells. Plates were tapped to mix and incubated at room temperature for 10 min. Plates were read using an optical density at 540 ± 20 nm on Synergy HTX multi-mode reader (BioTek US, Winooski, VT). Technical triplicate readings were averaged and experiments were run in biological triplicates.
RNA Immunoprecipitation Assay
The formaldehyde crosslinking RIP was performed as described (26). Briefly, precleaning lysates with 20 µl of PBS washed Magna ChIP Protein A + G Magnetic Beads (Millipore, Massachusetts). The precleaned lysate (250 µl) was then diluted with the whole cell extract buffer (250 µl), mixed with the specific antibody-coated beads, and incubated with rotation at 4 °C for 4 h, followed by 4 times washing with the whole cell extract buffer containing protease and RNase inhibitors. The collected immunoprecipitated RNP complexes and input were digested in RNA PK Buffer pH 7.0 (100 mM NaCl, 10 mM TrisCl pH 7.0,1 mM EDTA, 0.5% SDS) with addition of 10 µg Proteinase K and incubated at 50 °C for 45 min with end-to-end shaking at 400 rpm. Formaldehyde cross-links were reversed by incubation at 65 °C with rotation for 4 h. RNA was extracted from these samples using Trizol according to the manufacturer’s protocol (Invitrogen) and treated with DNA-free DNase Treatment & Removal I kit according to the manufacturer’s protocol (Ambion, Austin, TX). The presence of RNA was measured by quantitative RT-PCR using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Gene-specific PCR primer pairs are listed in Supplementary Table 1. The following antibodies were used for RIP analysis: anti-NF-κB p65 (Santa Cruz), normal mouse IgG (Santa Cruz).
Chromatin Immunoprecipitation Assay
Chromatin immunoprecipitation (ChIP) assays were performed as described previously (10). Briefly, cells were fixed with 1% formaldehyde for 10 minutes, collected in ice-cold PBS, and resuspended in an SDS lysis buffer. Genomic DNA was then sheared to lengths ranging from 200 to 1000 bp by sonication. One percent of the cell extracts was taken as input, and the rest of the extracts was incubated with either anti-NF-κB p65 (Santa Cruz), anti-H3K4me3 (Cell Signaling), anti-RNA Polymerase 2 (Millipore), or normal mouse IgG (Santa Cruz) overnight at 4 °C, followed by precipitation with protein G-agarose beads. The immunoprecipitates were sequentially washed once with a low-salt buffer, once with a high-salt buffer, once with an LiCl buffer, and twice with a Tris buffer. The DNA–protein complex was eluted, and proteins were then digested with proteinase K for 1 h at 45 °C. The DNA was detected by real-time quantitative PCR analysis. Gene-specific PCR primer pairs are listed in Supplementary Table 1.
Chromatin Isolation by RNA Purification
ChIRP analysis was performed as previously reported (36). Briefly, a pool of tiling oligonucleotide probes with affinity specific to the Nostrill sequence was used and glutaraldehyde cross-linked for chromatin isolation. The sequences for each probe are listed in Supplementary Table 1; probe 1, 3, 5, and 7 are mixed as the probe pool Odd and probe 2, 4, 6, and 8 as the probe pool Even. The DNA sequences of the chromatin immunoprecipitates were confirmed and quantified by real-time PCR using the same primer sets covering the gene promoter regions of interest as for ChIP analysis. A pool of oligo probes for LacZ were served as controls. The percent input method was used to normalize the ChIRP data.
Statistical Analysis
Data are expressed as mean values and error bars represent standard error of the mean (SEM). Student T test with Bonferroni’s correction or one- way ANOVA followed by Tukey-Kramer post hoc tests were performed where appropriate. For determination of significant differences between percents and for multiple comparisons between culture conditions, two-way ANOVA followed by Tukey-Kramer multiple analyses post hoc tests were used. Values of p < 0.05 were considered to be significant.