Materials
Bacterial lipopolysaccharide (LPS) (Escherichia coli serotype 055:B5), 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), and 2-dexoy-D-glucose (2-DG) 3-bromopyruvic acid (3-BPA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Mouse TNF-α Quantikine ELISA kit and mouse IL-6 Quantikine ELISA kit were obtained from R&D Systems (Minneapolis, MN). Antibodies used in this study were as follows: anti-p-IKKα (S176)/IKKβ (S177) (2078S), anti-IKKβ (8943S), anti-p-IκBα (S32) (2859S), anti-IκBα (4814S), anti-NF-κB p65 (8242S), anti–JNK (T183/Y185) (4668S), anti-JNK (9252S), anti-p-ERK 1/2 (9102S), anti-ERK 1/2 (4695S), anti-p-p38 (T180/Y182) (9215S), anti-p38 (9212S), anti-p-p70-S6K (T421/S132) (9204S), anti-p-mTOR (S2448) (2971S), anti-mTOR (2972S), and anti-p-AMPK (T172) (2535S) antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA); anti-iNOS (ab15323), anti-NF-κB p65 (acetyl K310) (ab19870) and anti-α-tubulin (ab7219) antibodies were from Abcam (Cambridge, MA, USA); and anti-Hexokinase Ⅱ(HK2) antibody was from Bioword Technology (St. Louis Park, MN, USA). Anti-tyrosine hydroxylase (TH) was obtained from Millipore (Billerica, MA, USA), and anti-Iba1 was purchased from Wako Chemicals (Chuo-ku, Osaka, Japan).
Cell culture
The BV-2 murine microglial cell line and human embryonic kidney (HEK) 293T cell line were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Carlsbad, USA) containing 10% fetal bovine serum (FBS, PAN Biotech and Lonsera, Aidenbach, Germany), 100 U/mL penicillin and 100 µg/mL streptomycin (Gibco). MES23.5 dopaminergic cells require Dulbecco's modified Eagle’s medium/nutrient mixture F-12 (DMEM/F-12, Gibco) with 5% fetal bovine serum (FBS, PAN Biotech and Lonsera), 100 U/mL penicillin (Gibco), 100 µg/mL streptomycin (Gibco) and 100x insulin-transferrin-selenium (Gibco). All three cell lines were cultured in an incubator at 37 °C in a 5% CO2 atmosphere.
Primary culture of microglia
Primary cultures of microglia were collected from newborn C57BL/6J mice [22]. In summary, the newborn mice were washed in 75% alcohol, and the whole brains were isolated and minced in precooled PBS. Then, the cortical tissue was digested for 20 min with 0.25% trypsin. After centrifugation and resuspension, the samples were digested by DNaseI at 37 °C and transferred to a single cell suspension. Then, single cells were plated on poly-D-lysine-coated flasks for 14 days. The microglial cells were obtained from mixed glial cultures on a shaker at 180 rpm for 3 hours.
Nitric oxide (NO) measurement
The BV2 cell line was cultured in a 96-well plate at a density of 2.0 × 104 cells/well. After LPS or/and compound stimulation for 24 hours, 50 µl of cell culture supernatant was transferred to a new 96-well plate and mixed with 50 µl of Griess reagent. The signals were measured in a microplate reader (Infinite M200 PRO, Tecan, Switzerland) at 550 nm. The data were normalized to a standard curve.
Cytotoxicity assay
Cell viability was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. In brief, after appropriate treatment of BV2 cells, 30 µl of MTT (Solarbio, Beijing, China) was added to each well and incubated at 37 °C for 4 hours. The samples were mixed with 100 µl of DMSO and detected at 540 nm by a microplate reader (Infinite M200 PRO).
Enzyme-linked immunosorbent assay (ELISA)
The concentrations of TNF-α and IL-6 in the medium were detected by mouse TNF-α or IL-6 ELISA kits according to the manufacturers’ instructions.
RNA isolation and quantitative real-time PCR
Total RNA from the BV2 cell line or tissues was isolated by TRIzol reagent and subjected to reverse transfection by Oligo-d(T) and M-MLV reverse transcriptase (Thermo Fisher). Real-time quantitative PCR was performed on an Applied Biosystems 7500 Real-Time PCR system (Foster City, CA, USA) using PrimeScript RT Master Mix (TaKaRa, Dalian, China). The specific primers used in reverse transcription were purchased from GENEWIZ (Suzhou, China) as shown in Table 1. Gapdh was used as a control. The normalized CT values were calculated according to the comparative delta-delta Ct method.
Table 1
primers used in real-time quantitative PCR
Primer
|
Sequence(5'-3')
|
mus-GAPDH
|
Forwad:
|
TGTGTCCGTCGTGGATCTGA
|
Reverse:
|
TTGCTGTTGAAGTCGCAGGAG
|
mus-iNOS
|
Forwad:
|
TAGGCAGAGATTGGAGGCCTTG
|
Reverse:
|
GGGTTGTTGCTGAACTTCCAGTC
|
mus-COX-2
|
Forwad:
|
CAGGCTGAACTTCGAAACA
|
Reverse:
|
GCTCACGAGGCCACTGATACCTA
|
mus-TNF-α
|
Forwad:
|
CAGGAGGGAGAACAGAAACTCCA
|
Reverse:
|
CCTGGTTGGCTGCTTGCTT
|
mus-IL-1β
|
Forwad:
|
TCCAGGATGAGGACATGAGCAC
|
Reverse:
|
GAACGTCACACACCAGCAGGTTA
|
mus-IL-6
|
Forwad:
|
GCCAGAGTCCTTCAGAGAGA
|
Reverse:
|
GGTCTTGGTCCTTAGCCACT
|
mus-HK2
|
Forwad:
|
TCATTGTTGGCACTGGAAGC
|
Reverse:
|
TTGCCAGGGTTGAGAGAGAG
|
mus-Glut-1
|
Forwad:
|
CAGTTCGGCTATAACACTGGTG
|
Reverse:
|
GCCCCCGACAGAGAAGATG
|
mus-LDHA
|
Forwad:
|
TGTCTCCAGCAAAGACTACTGT
|
Reverse:
|
GACTGTACTTGACAATGTTGGGA
|
mus-G6pdx
|
Forwad:
|
CACAGTGGACGACATCCGAAA
|
Reverse:
|
AGCTACATAGGAATTACGGGCAA
|
Western blotting
BV-2 cells and 293T cells were lysed on ice for 30 min and shaken every 10 min in denaturing lysis buffer (50 mmol/L Tris [pH 8], 1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate, 150 mmol/L NaCl and PMSF), while mouse tissue (the substantia nigra and the striatum) was measured by an ultrasound system before being lysed on ice. After mixing with 5x loading buffer, the proteins were separated by SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane, followed by blocking in milk for 2 hours. Then, the samples were incubated with the appropriate primary antibodies and HRP-conjugated secondary antibodies. Finally, proteins were detected by enhanced chemiluminescence (ECL) (Millipore) with a ChemiScope 3300 mini (CLINX, Shanghai, China).
Plasmids and siRNA transfection
BV-2 cells were seeded on a 12-well plate (5.0 × 104 cells/well) one day prior to transfection. the cells were transfected with appropriate siRNA or plasmids accompanied by transfection reagents (Lipofectamine®RNAiMAX or Lipofectamine 2000) according to the manufacturer’s instructions. After 24 hours, the cells were collected for subsequent experiments. The siRNA sequences are shown in Table 2.
Table 2
si-RNA used in RNA interference
Gene
|
siRNA
|
Sense (5'-3')
|
mus-HK2
|
siHK2
|
GGAGAUGCGUAAUGUGGAATT
|
mus-Glut-1
|
siGluT-1
|
GCUGCCUUGGAUGUCCUAUTT
|
mus-LDHA
|
siLDHA
|
CCACCAUGAUUAAGGGUCUTT
|
mus-G6pdx
|
siG6pdx
|
GGAGUUCUUUGCCCGUAAUTT
|
Coimmunoprecipitation (IP)
Protein was extracted in nondenaturing lysis buffer (20 mM Tris HCl [pH 8], 137 mM NaCl, 1% Nonidet P-40 (NP-40) and 2 mM EDTA), followed by incubation with appropriate antibodies overnight. Then, the samples were mixed with protein A/G beads for 4 hours, and then, the beads were washed 10 times to remove nonspecifically bound proteins. The beads and protein were mixed with 2x loading buffer and separated in boiling water, followed by Western blotting.
NF-κB luciferase reporter assays
BV-2 cells stably expressing the NF-κB reporter were seeded on a 12-well plate one day before compound and LPS (200 ng/ml) stimulation. After 16 hours, the cells were lysed in reporter lysis buffer, and luciferase activity was detected with a dual-luciferase assay kit following the manufacturer’s protocol (Promega, USA).
MPTP-induced PD model
All mice (male, C57BL/6J) were obtained from Shanghai SLAC Laboratory Animal Co. Ltd. (Shanghai, China) and placed in an SPF laboratory animal room. All the experiments used in this research followed the Guide for the Care and Use of Laboratory Animals (8th edition) and were approved by the Institutional Animal Care and Use Committee of Soochow University. In this experiment, mice were allocated to 4 groups: saline, 2-DG alone (400 mg/kg), MPTP alone (30 mg/kg) and 2-DG (400 mg/kg) + MPTP (30 mg/kg). For the 2DG + MPTP group, 2-DG was given 3 days prior to MPTP injections. MPTP was injected for 7 consecutive days, and 2-DG was preadministered 2 hours before MPTP injection. The rotarod test and pole test were performed on the 11th day. After behavioral tests, mouse brain tissue was collected for further study.
LPS-induced PD model
Mice were separated into 4 groups: saline, 2-DG alone (400 mg/kg), LPS alone (5 mg/kg) and 2-DG (400 mg/kg) + LPS (5 mg/kg). For the 2DG + LPS group, 2-DG was given 3 days prior to LPS injections. LPS was stereotactically injected into the SNc on the third day, and 2-DG was administered for 7 consecutive days. On the 11th day, the mice were euthanized and brain tissue was collected for further study.
Rotarod test
Before the test, mice were trained on the rotarod for 10 min. During testing, the mice were placed on the rotarod with increasing speed from 4 rpm/min to 40 rpm/min, and the time when mice fell from the rotarod was recorded. The test for each mouse was recorded 3 times. The average of three trials was used as a statistical indicator [23].
Pole test
The pole used in this experiment is a wooden stick with a wooden ball on the top that has a rough surface. During testing, mice were placed on the wooden ball, and the time for the mice to climb from the ball to the base of the stick was recorded. The test for each mouse was recorded 3 times. The average of three trials was used as a statistical indicator.
Immunohistochemistry
The mice were euthanized, and normal saline was perfused into the left ventricle, followed by paraformaldehyde (4%) perfusion. After perfusion, the mouse brains were collected and fixed in phosphate-buffered paraformaldehyde for three days at 4 °C and then dehydrated in 30% sucrose solutions until they sank. The brain was frozen and cut into 20 µm slices with a freezing microtome. For immunofluorescence staining, the brain slices were washed in PBS and blocked with fetal bovine serum (FBS). Then, the samples were soaked with the appropriate antibody overnight. The next day, brain slices were washed in PBST for 30 min before or after incubation with secondary fluorescent antibodies for 2 hours in the dark. The samples were placed on a microscope slide and observed by confocal microscopy.
ADP/ATP ratio assay
An ADP/ATP Assay Kit (Sigma-Aldrich) was used in the ADP/ATP ratio assay. In brief, BV2 cells were seeded in a 12-well plate (1 × 105 cells/well). After LPS or/and compound stimulation for 16 hours, the cells were digested and collected in a centrifuge tube. Then, the cells were seeded in a 96-well plate with a white background (1 × 104 cells/well). The ATP reagent was prepared and added to each well. The samples were placed at room temperature for 1 min and measured by a luminescence reporter assay system (Promega, Madison, WI, USA). The value was recorded as [(RLU)A]. After 10 min, the samples were measured again as [(RLU)B]. After recording [(RLU)B], 5 ml of ADP reagent was prepared and added to samples without delay. Then, the samples were incubated at room temperature for 1 min before the luminescence was detected as [(RLU)C]. The ADP/ATP ratio was calculated following the manufacturer’s instructions.
NAD+/NADH assay
After LPS or/and compound stimulation for 16 hours, BV2 cells were digested and resuspended into two precooled tubes. Then, 100 µl of NAD extraction buffer or NADH extraction buffer was prepared and added to each tube. After heating at 60 °C for 5 min, 20 µl of assay buffer and 100 µl of the opposite extraction buffer were added to each sample, followed by centrifugation at 14,000 rpm for 5 min. Finally, 80 µl of working reagent was added to each sample, and the optical density was detected immediately (OD0) and 15 min later (OD15). NAD+/NADH was calculated according to the manufacturer's instructions.
Extracellular flux assays
Extracellular flux assays (Seahorse Bioscience, Chicopee, MA) were used to measure the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of BV2 cells. BV2 cells were plated in a Seahorse XF microplate at a density of 2.0 × 104 cells/well and cultured overnight. Then, the plate was balanced in a non-CO2 incubator at 37 °C for 30 min. Meanwhile, Seahorse XF Glycolysis stress test kit assay medium was prepared, and glutamine was added to Seahorse XF Base Medium. Finally, the compounds were diluted in assay medium and added to the microplate. The ECAR and OCR were measured in an Agilent Seahorse XFe/XF96 or 24 Analyzer.
Coculture
BV2 cells were cultured in a 6-well plate at a density of 2.0 × 105 cells/well. Twenty-four hours later, the supernatant was collected as conditioned medium prior to LPS stimulation, and the compounds were stimulated for 6 hours. MES23.5 dopaminergic neural cells were cultured in a 96-well plate (2.0 × 104 cells/well), and after 12 hours, the conditioned medium was added to MES23.5 for 24 hours. Then, cell viability was measured by MTT assay and flow cytometry.
Flow cytometry
BV2 cells were treated with 2-DG for 30 min prior to lipopolysaccharide (LPS)-Alexa Fluor® 488 (L23351, Invitrogen, CA, USA) stimulation. After 2 hours, Cells were resuspended and washed in PBS for 3 times. The cell-associated fluorescence was measured by flow cytometry analysis (Beckman Coulter, Brea, CA, USA).
Statistical analysis
All data are presented as the mean ± standard deviation (S.D.) from at least three independent experiments and analyzed with GraphPad Prism software (version 8.0.1; San Diego, CA, USA). Comparisons between multiple groups were analyzed by one-way analysis of variance (ANOVA) or two-way analysis of variance (ANOVA) with Tukey’s test. P < 0.05 was considered statistically significant.