Animals model and experimental groups
Experiments were conducted according to the Guide for the care and Use of Laboratory Animal of National Institutes of Health (NIH Publication No.86 − 23, revised 1996) and approved by the Animal Research Ethics Committee of Kunming Medical University.
Eight-week-old male Sprague-Dawley rats, weighing 200-220g, were from the experimental animal center of Kunming Medical University. All rats, kept with 12h light/dark cycles at a constant temperature of 22 ± 3°C and more than 60% humidity, were fed adaptively for one week before experiment. The type 2 diabetic rat models were referred to the protocol reported in previous studies29. They were divided into three groups: normal control group (NC, n = 10), type 2 diabetes mellitus group (T2DM, n = 10) and OED-treated type 2 diabetes mellitus group (T2DM + OED, n = 10). OED was supplied from Suzhou Auzone Biotech (Fuzhou, Jiangsu). T2DM and T2DM + OED groups were fed on high glucose and high fat diet (comprising 52% standard chow diet, 18.5% protein, 10% fat, 15% saccharose, 3% egg powder, 1.5% cholesterol) and NC group was fed on standard chow diet in the entire process. All diets were obtained from the experimental animal center of Kunming Medical University. After 4 weeks, all rats were fasted for 12h before intraperitoneal injection to induce diabetes. Low dose STZ (35mg/kg,dissolved in 0.1M citrate buffer solution, PH 4.5) was injected in diabetic-induced rats and NC group was given equivalent volume of citrate buffer. Blood glucose and body weight were tested at day 1, 3, 7 and once a week for the rest of the experiment. Glucose levels consistently above 16.7mmol/L were enrolled. After STZ injection for one week, T2DM + EDA group was treated with OED (3mg/kg/d) by oral administration for four weeks. In the T2DM group, two rats died due to hyperglycemic hyperosmolar.
Transthoracic echocardiography
Transthoracic echocardiography was performed to evaluate cardiac function of rat at experiment termination. All rats underwent transthoracic motion mode (M-mode), pulsed-wave Doppler (PWD) and two-dimensional echocardiography after anesthetized by 10% Chloral hydrate at a concentration of 0.3ml/100g. A blinded investigator used Philip EPIQ 7C machine equipped with a 3-12MHz surface probe to measure heart rates (HR), early diastolic peak velocity (E velocity), late diastolic peak velocity (A velocity), left ventricular internal dimension (LVIDd), left ventricular internal dimension in systole (LVIDs), interventricular septal thickness in diastole (IVSd), interventricular septal thickness in systole (IVSs), left ventricular posterior wall thickness at end diastole (LVPWd), left ventricular posterior wall thickness at end systole (LVPWs) and left atrial diameter (LAD) in two-dimensional and M-mode imaging. Besides, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), ratio of E and A velocity (E/A ratio), left ventricular mass (LVM) and ratio of left ventricular mass and body weight (LVW/BW) were calculated for analysis.
Tissue samples
At the end of experiment, rats were anesthetized by intraperitoneal injection with pentobarbital (30 mg/kg). After phosphate buffered saline (PBS, Solarbio life sciences, Beijing, China) perfusion, all myocardial samples were quickly divided to liquid nitrogen and 4% paraformaldehyde for the next detection. For producing histopathological sections, the myocardial tissue were embedded in paraffin and cut to 5um. Protein was extracted using RIPA buffer (Beyotime Biotechnology, Shanghai, China) supplement with protease inhibitors (Roche Diagnostics GmbH, Mannheim, Germany). Isolation of myocardial cytoplasmic and nuclear components was performed according to the kit instructions (78833, Thermo Scientific, Massachusetts, US). Concentration of protein was determined by BCA assay kit (PC0020, Solarbio life sciences, Beijing, China).
Enzyme linked immunosorbent assay (ELISA) analysis for Myocardial superoxide dismutase (SOD) and malondialdehyde (MDA)
The contents of SOD and MDA in tissue were determined according to the instructions of ELISA kits (JiangLai bio Ltd, shanghai, China.). SOD and MDA was expressed as ng/ml and nmol/ml individual.
Hematoxylin and eosin (HE) staining and Masson staining
Paraffin embedded sections, sticking on glass slides, were stained with HE and Masson separately (Solarbio, Beijing, China). Five visualized fields of left ventricle sections were randomly captured with microscope (Leica, Germany) and Image Pro Plus6.0 software was used to calculate cardiomyocyte cross-sectional area and the area fraction of collagen.
Immunohistochemistry
Myocardial tissue sections and primary antibody against collagen I (GB11022-3, Servicebio, Wuhan, China) and collagen III (GB13023-2, Servicebio, Wuhan, China) were incubated in 4°C refrigerator overnight. After washed with Phosphate Buffer Saline (PBS, Solarbio, Beijing, China) for three times, the second antibody was added and incubated at room temperature for 1 hour. Images were captured and data were analyzed using Image Pro Plus6.0.
Terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL)
Cell apoptosis was detected by Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL). According to the instructions of TUNEL kits (Roche Diagnostics GmbH, Mannheim, Germany; TUNEL BrightGreen Apoptosis Detection Kit, Vazyme, Nanjing, China), the slides were incubated with TUNEL reaction mixture at 37°C for 60 minutes. The apoptotic index was calculated as a percentage of positive apoptotic cells to the total cells.
Cell culture and transfection
H9C2 cells were obtained from ATCC (CRL-1446, Manassas, US) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, ATCC, Manassas, US) supplemented with 10% fetal bovine serum (FBS, Gibco, California, US) and 1% penicillin-streptomycin (Gibco, California, US), and maintained in a humidified incubator containing 5% CO2 at 37°C. Passages 2–8 of cells were used in the experiment. Transfection of cells was performed according to the manufacturer's instructions. H9c2 cells were transfected when reached 40% − 50% confluence. Nrf2 siRNA (sc-156128, Santa Cruz Biotechnology, US), control siRNA (sc-36869, Santa Cruz Biotechnology, US), and lipofectamine2000 (11668, Invitrogen, Thermo Scientific, Massachusetts, US) were diluted using opti-MEM (Gibco, California, US). Transfection was performed in medium without serum and antibiotic. After 7 hours, normal growth medium containing serum and antibiotics were added into plates and incubated the cells for an additional 24 h. The effect of gene silencing was confirmed using quantitative real-time polymerase chain reaction and western blotting. Cells were divided into five groups: normal group (NG, 25 mM glucose), high glucose and high fat group (HG/HF, 50mM glucose and 150uM sodium palmitate), and HG/HF with edaravone group (HG/HF + OED, 10ug/L edaravone), HG/HF + OED with Nrf2 siRNA group (HG/HF + OED + siNrf2) and HG/HF + OED with NC siRNA group (HG/HF + OED + siNC). After transfection, cells received OED (10ug/L) treatment for 48h in the condition of high glucose and high fat, except the normal group.
Cell viability
Cell counting kit-8 (Lot.GB707, Dojindo Laboratories, Tokyo, Japan) was used to detect cell viability. H9C2 cells were seeded in 96-well plate in triplicate and performed according to the experimental protocol. After washed twice by PBS (Gibco, California, US), each well was added 10ul CCK8 solution in new medium. The absorbances of 450nm and 600nm were measured by multimode reader (Synergy H1, Biotek, US) after 2h in a humidified incubator at 37°C.
Measurement of cardiomyocyte surface area
H9c2 cells were stained with actin-stain 555 fluorescent phalloidin (PHDH1, cytoskeleton, US) for measure surface area. Cells were seeded on coverslips in 24-well plate. After fixation and permeabilization, cells were incubated with phalloidin for 30 minutes in the dark. The nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, Beyotime Biotechnology, Shanghai, China). Rinsing the coverslip in PBS and inverting on a drop of anti-fade mounting media (H-1000-10, Vector labs, California, US) on a glass slide were performed. Cell surface areas were determined with Image Pro Plus 6.0.
Detection of intracellular ROS
The intracellular ROS level were measured by 2’,7’-dichlorofluorescin diacetate (DCFH-DA, D6883, Sigma-Aldrich, US) according to the manufacturer’s instructions. H9C2 were seeded in 24-well plate. After removed the original culture solution, the wells were washed with PBS twice. DCFH-DA, dissolved with DMSO (D2650, Sigma-Aldrich, US) to a final concentration of 10ng/ml, was added 10ul per well and incubated at 37°C in the dark for 20min. Cells were washed three times using PBS. Subsequently, Fluorescence was monitored by invert fluorescence microscope (Leica, Germany) and photographed. The average optical density of ROS was measured using Image J.
Hoechst 33342 staining
The apoptotic nucleuses were observed with Hoechst33342. Cell culture and groups were the same as DCFH-DA treatment. Cells were fixed with 4% paraformaldehyde for 20 minutes and the plates were washed 3 times with PBS for 5 minutes each time. 10ul of Hoechst33342 (B2261, Sigma-Aldrich, US, 200ug/ml in PBS,) was added to each well and incubated 5 minutes in the dark. Finally, anti-fade mounting media was used to seal the coverslips. Staining was observed in the fluorescence microscopy.
Total RNA extracted and quantitative real-time polymerase chain reaction analysis
Total RNA was extracted with TRIzol reagent (15596026, Invitrogen, Thermo Scientific, Massachusetts, US) following the manual and DNA was generated by RevertAid First Strand cDNA Synthesis Kit (K1622, thermo scientific, Massachusetts, US). Quantitative real-time PCR was performed by SYBR green PCR master mix (D7260, Beyotime Biotechnology, Shanghai, China) on CFX96 instrument. The reaction procedure was as follows: heating at 95°C for 5minutes and magnification over 40 cycles of 95°C for 15seconds, 60°C for 30seconds and 95°C for 15 seconds. The primer sequence was as follows:
Myh7 Forward: CCAGAACACCAGCCTCATCAACC
Myh7 Reverse: CACCGCCTCCTCCACCTCTG
Nfe2l2 Forward: GCCTTCCTCTGCTGCCATTAGTC
Nfe2l2 Reverse: TGCCTTCAGTGTGCTTCTGGT TG
Hmox1 Forward: AGGAGATAGAGCGAAACAAGCAGAAC
Hmox1 Reverse: GCTGTGTGGCTGGTGTGTAAGG
Nqo1 Forward: GCTTCTGTGGCTTCCCAGGTC
Nqo1 Reverse: CGCTTCTTCCACCCTTCCAG
The expression of GAPDH was used as the control.
Western Blotting
Equal protein form cardiac tissue and H9C2 cells were loaded onto the SDS-PAGE gel, prepared according to the kit, and transferred to the polyvinylidene fluoride (PVDF) membrane (Millipore, Massachusetts, US). Then, the membrane was incubated with primary antibody against Nrf2 (CST #20733, Massachusetts, US), HO-1 (proteintech 10701, Wuhan, Hubei, China), NQO1 (proteintech 67240, Wuhan, Hubei, China), Caspase-3 (CST #9662, Massachusetts, US), Bcl-2 (sc-7382, Santa Cruz Biotechnology, US), Bax (CST #2772, Massachusetts, US), GAPDH (Cat No.GTX10018, Gene Tex, US) at 4°C overnight and incubated with HRP-conjugated secondary antibody(CST #7076,#7074༌Massachusetts, US) for 1 hour. We used gel imaging analysis system to visualize the protein signal. Image J software was used for semi-quantitative analysis.
Data statistics and analysis
The experimental data were expressed as mean ± standard error (SEM). Data conform to normal distribution. One-way analysis of variance (ANOVA) was used for statistical analysis. Brown-Forsythe and Welch ANOVA tests were used when variances were not homogeneous (Graphpad Prism 8.0). P value less than 0.05 was considered significant difference.