Cell culture
The HCT116 cells were cultured as described in the literature28.
Isolation and culture of human adipose-derived MSCs (hAD-MSCs)
We collected adult fat samples from Peking Union Medical College Hospital after acquiring informed consent from the patients. The adipose tissue was washed three times using D-Hanks' buffer with penicillin/streptomycin, and then centrifuged at 800 g for 3 min. The supernatant was transferred into a fresh 50 ml centrifuge tube. And the pelleted tissue was treated with 0.2% collagenase P (Life Technology Corporation) at 37°C for 30 min. Finally, the 100-µm cell strainer was used to disintegrate the adipose tissue. After centrifuging the sample at 1500 g for 10 min, the cells were seeded into T75 flasks, and incubated at 37°C in an incubator with 5% CO2.
Extraction of H-exos
DMEM/F-12 medium (Life Technology Corporation) was used instead of hAD-MSC culture medium including FBS, and after 36h, we collected the supernatant and centrifuged it at 3000 g for 30 min. The supernatant was added to an ultrafiltration tube with a 100,000 molecular weight ultrafiltration membrane (Life Technology Corporation). Exosomes were washed twice using D-Hanks' buffer, and the sample was filtered through a 0.2-µm pore-size membrane, aliquoted and preserved at −80°C.
Exosome uptake
A solution comprising 1 µM 1,1-dioctadecyl-3,3,3,3-tetramethyl indotricarbocyanine iodide (DIR) (Life Technology Corporation) was added to the purified exosomes and incubated for 30 min at room temperature. Subsequently, exosomes were added to the MSC culture medium for 6 h. Next, the supernatant was discarded, the cells were washed twice using phosphate buffered saline (PBS), and then Hoechst 33342 was added to stain the nuclei (1:1000 dilution) for 10min at room temperature. The images were obtained using a conventional fluorescence microscope (OLYMPUS).
Clonogenicity assay
First, 1×103 MSCs were seeded into each well of a 6-well plate (Corning) containing MSC medium with or without or exosomes, PYR3 (inhibitor of TRPC3) or OAG (activator of TRPC3). After 12 days, the colonies were fixed with 4% paraformaldehyde for 10 min, and then stained with (0.5% w/v) crystal violet for 40 min. The samples were gently washed with sterile PBS and photographed under a microscope.
Cell-cell co-culture system
The co-culture of 4x105 HCT116 cells with the 4x105 hAD-MSCs at a 1:1 ratio was in the Transwell® chamber (0.4µm) (Corning). MSCs were seeded into the upper insert, while HCT116 cells were placed in the lower chamber. Both MSCs and HCT116 Cells were passaged when at 90% confluence. Samples were collected at days 0, 3, 5, 7, and 9 for further analysis.
siRNAs transfection and virus infection
The siRNAs that were used to knock down TRPC3 mRNA expression (Table 1) were synthesized by GenePharma company (China). The procedure for virus infection was described in a precious report29.
Table 1
items | direction | sequence |
IL6 primer | sense | ACTCACCTCTTCAGAACGAATTG |
reverse | CCATCTTTGGAAGGTTCAGGTTG |
IL8 primer | sense | ACTCCAAACCTTTCCACCCC |
reverse | TTCTCAGCCCTCTTCAAAAACTTC |
GAPDH primer | forward | GGTCACCAGGGCTGCTTTTA |
reverse | GGATCTCGCTCCTGGAAGATG |
TRPC3 primer | forward | AGCCAACACGTTATCAGCAG |
reverse | CCAGGTTGCTGCATCATTCAC |
Cell proliferation assay (MTS)
The specific procedures were the same as described in a previous report30.
Cell Counting Kit-8 (CCK8)
The CCK-8 assay was used to detect MT-CAF proliferation in the presence of either PBS, exosomes, exosomes+PYR3 or OAG, respectively. The cells were cultured in 96-well plates with five replicate wells for each treatment. After the cells were cultured for 0, 1, 2, 3 and 4 days, 10 µl CCK-8 solution was added to each well and incubated for 1h at 37°C in the cell-culture incubator with 5% CO2. Finally, the absorbance of each well was measured at 450 nm.
Western blot analysis
Western blotting was done as described previously30. The TRPC3 (sc-514670, 1:1000), IL-6 (12912, 1:1000), AKT (9272,1:1000), ERK (4695,1:1000), p-ERK1/2 (4370, 1:1000), p-SMAD3(9520, 1:1000), NF-KB(8242, 1:1000), p-NF-KB (3033, 1:1000) anti-rabbit IgG-HRP (14708,1:2000), and anti-mouse IgG-HRP (14709,1:2000) antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA); IL-8 (500-M08, 1:1000), SMAD3 (25494-1-AP, 1:1000) and p-Akt (ser473, 66444-1-IG,1:2000) antibodies were purchased from Proteintech (Chicago, IL, USA).
RNA extraction and quantitative reverse transcription-polymerase chain reaction (qRT-PCR)
Total RNA was obtained using the Trizol reagent (Thermo Fisher Scientific, USA), and qRT-PCR was performed as described previously30. All the primer sequences are listed in Table S1.
Cell invasion and migration assay
Colorectal cancer cell migration and invasion was assayed using 24-well Matrigel-coated Transwell inserts (BD Biosciences, San Diego, CA, USA). Invasion and migration of MT-CAFs and HCT116 cells was assayed using previously reported procedures30.
Immunohistochemistry (IHC) staining
The tumor tissue samples were fixed with 4% formaldehyde, embedded in paraffin, and sliced into 4 µm thick sections. The samples were further de-waxed and hydrated. Intrinsic peroxidases were inactivated with 3% H2O2, and the nonspecific protein-binding sites were blocked by adding 10% normal goat serum. The blocked slides with incubated with the primary antibody (1:50) overnight at 4 C. Then, the secondary antibody was diluted 1:100 in sterile PBS and contacted with the slides at room temperature for 2 h. Finally, hematoxylin was used to counter-stain all immunostained sections. Two pathologists who were blinded to the patients’ information evaluated the results of IHC independently. If the result was inconsistent, it was judged by a third pathologist. TRPC3 positivity was defined as IHC staining of ༞5% of the cells.
Immunofluorescence (IF) staining
The cultured cells were washed twice with PBS for 5min, fixed in 4 % formaldehyde for 20 min at room temperature, and washed three times with PBS. Then, 0.1% Triton X-100 in PBS was used to permeabilize the cells for 10 min. Nonspecific binding was blocked with 10% normal goat serum for 30 min. The samples were incubated with the primary antibody (NF-κB, 1:50) at 4°C overnight, followed by incubation with the secondary Alexa Fluor 488 goat anti-rabbit IgG at room temperature for 1 h. The samples were washed with PBS, and the nuclei counterstained with Hoechst 33342 (Gibco).
Fluorescent double staining (ACTA2/TRPC3) was done similarly to the immunohistochemistry (IHC) staining, but the secondary Alexa Fluor 488 goat anti-rabbit IgG and Alexa Fluor PE goat anti-rabbit IgG antibodies were contacted with the samples at room temperature for 1 h. The results were observed by confocal laser scanning microscopy (Olympus).
Xenograft assay in nude mice
For the subcutaneous tumor model, mice were divided into three groups (n=7). One was only injected with 5×106 HCT116 cells, one group was co-injected with 1×106 MSCs and 5×106 HCT116 cells, and the third group was was co-injected with 1×106 MSCs with TRPC3 knockdown and 5×106 HCT116 cells. The specific methods were reported in the literature30.
Agilent expression profiling gene chip
Total RNA was extracted using Trizol from MSC cells cultured alone (0 day) and co-cultured with HCT116 cells for the indicated times (1, 3, 5, 7, and 10 days). Sample processing and procedures were done as described in a previous article30.
Clinical specimens
After obtaining informed consent, colorectal cancer specimens were obtained from 63 patients in Peking Union Medical College Hospital (PUMCH) between January 2014 and December 2016. All patients received complete resection and pathologically diagnosed as stage I-III colorectal cancer. All the protocols were approved by the Ethics Committee of PUMCH.
Written Informed Consent
All participants provided written informed consent to take part in the study
Statistical analysis
All data are expressed as means ± SD from at least three independent experiments, and statistical analysis was performed using two-tailed Student’s t-test and one-way ANOVA. Differences with P-values < 0.05 were considered statistically significant.