Animals and treatment
All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania. For all experiments, 6- to 8-week-old, 17-to-20 g, inducible Cre (UBC-CreERT2) (13) (The Jackson Laboratory stock #007001), RSPO2 flox mice (a gift from Dr. Kurt Hankenson, University of Michigan) and C57BL/6 mice of both sexes were used in equal proportions. For all animal studies, no statistical method was used to predetermine sample size. The experiments were not randomized, and the investigators were not blinded to allocation during the experiments and outcome assessment.
Animal euthanasia
Mice were placed into a chamber and exposed to isoflurane (Midwest Veterinary Supply) concentration ≥ %5 until roughly one minute after breathing stopped. Cervical dislocation was then performed as a secondary method after isoflurane overdose. This method is approved by our IACUC committee.
Cre recombination
To induce CreERT2 recombination, three doses (1 mg/g body wt, days) of tamoxifen (TM) dissolved in 100 µl of Mazola® corn oil were administered via intraperitoneal injection to all mice (RSPO2−/− n = 3; RSPO2+/+ n = 3; c57BL/6 n = 3) were treated at day 0 to 4. Primers used to detect Cre-recombination are as follows: Rspo2-floxA-Forward: ACTCTTACTGCCTGGGATCCTCATT, Rspo2-floxB-Reverse: CTTCTTCTGAGCACCATCTGC. To induce CreERT2 recombination in cultured lung fibroblasts, cells were treated with three doses (4 mM) of 4-Hydroxytamoxifen (4-OHT) dissolved in dimethyl sulfoxide (DMSO; Santa Cruz Biotechnology).
Lung fibroblast isolation and culture
Lung fibroblasts were isolated by inflating fleshly dissected mouse lungs with 15 U/mL dispase II (Gibco™) in Hank’s Balanced Salt Solution (HBSS; Gibco™), tying off the trachea, cutting away lobes from the mainstem bronchi, placing them into dispase to incubate for 45 minutes shaking at room temperature and mechanically dissociated by pipetting in sort buffer (SB; Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific) + 20% cosmic calf serum (CC; Thermo Fisher Scientific) + 5% 5,000 U/mL penicillin-streptomycin (P/S; Gibco™). After pelleting at 570 x g for 5 minutes at 4 °C, whole-lung suspension was treated with Red Blood Cell Lysis Buffer (Millipore Sigma) for 3 minutes, pelleted, and suspended in SB + 1:1000 DNase I (Millipore Sigma) for a 45 minutes recovery period shaking at 37 °C. Whole-lung suspension was then pelleted and suspended in SB.
1 × 107 cells were plated into a Corning® 6-well clear polystyrene flat-bottom microplate (Millipore Sigma) in DMEM + 20% CC + P/S and grown in a 37 °C incubator for 9 days without passaging with media changes roughly on days 3 and 6 before harvesting for mRNA or cytospins.
BALF collection
After the trachea was exposed, a 20-G catheter was inserted into the trachea for lavage. One milliliter of cold PBS was instilled into the mouse lungs followed by gentle aspiration repeated three times.
Immunofluorescence
BALF and fibroblast cytospin slides were blocked and stained in a solution of PBS + 1% BSA (Affymetrix), 5% nonimmune horse serum, 0.1% Triton X-100, and 0.02% sodium azide. Slides were blocked for 1 hour at 4 °C. Slides were then incubated in primary antibodies as listed below in blocking buffer overnight at 4 °C. Slides were then washed three times with cold PBS + 0.1% Tween-20 (Millipore Sigma) and subsequently incubated with secondary antibodies as listed below for > 2 h at room temperature. Slides were then washed three times in PBS prior to 1 µM DAPI (Life Technologies) incubation for five minutes and mounted with Prolong Gold (Life Sciences).
The following primary antibodies were used for immunofluorescence: goat anti-myeloperoxidase (MPO) (1:200 dilution; R&D Systems), rabbit anti-RSPO2 (1:200 dilution; Proteintech). The following secondary antibodies were used for immunofluorescence: Alexa Fluor 488-conjugated donkey anti-goat (1:1000, Thermo Fisher Scientific), Alexa Fluor 568-conjugated donkey anti-rabbit (1:1000, Thermo Fisher Scientific).
Quantification of BALF tissue immunofluorescence
To quantify MPO + cells, mosaic images covering entire BALF cytospins were generated from multiple 20 X fields captured on an upright fluorescence microscope (model DMi8, Leica) and tiled in LAS X software (Leica). The MPO + cells were manually counted, and the ratio of MPO + cells to DAPI + cells was calculated. At least three sections per slide (RSPO−/− n = 3; RSPO+/+ n = 3), each containing ≥ 300 individual cells, were quantified for each mouse sample.
Quantitative PCR (qPCR) analyses and primers
RNA was isolated from both BALF and cultured fibroblasts using RNeasy™ (Qiagen). The amount of RNA input for cDNA synthesis was standardized within each experiment to the RNA isolate with the lowest concentration as measured by Nanodrop (Thermo Fisher Scientific). cDNA was synthesized using iScript™ Reverse Transcription Supermix (BioRad). RT-PCR reactions were performed using SsoAdvanced™ Universal SYBR® Green Supermix (Biorad) and run on an Applied Biosystems QuantStudio 6 Real-Time PCR System (Thermo Fisher Scientific).
Expression of each gene is relative to expression of mouse RPL37 (L37), RPL19 (L19), or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. The primer sequences are as follows GAPDH – Forward: AGGTCGGTGTGAACGGATTTG, Reverse: TGTAGACCATGTAGTTGAGGTCA, L37 – Forward: CTCGGAGGTTACGGGACTC, Reverse: CTTGCCCTCGTAGGTAATGGG, L19 - Forward: ATG TAT CAC AGC CTG TAC CTG, Reverse: TTC TTG GTC TCT TCC TCC TTG, MPO – Forward: AGTTGTGCTGAGCTGTATGGA, Reverse: CGGCTGCTTGAAGTAAAACAGG, and RSPO2 – Forward: AGACGCAATAAGCGAGGTGG, Reverse: CTGCATCGTGCACATCTGTT
FITC-dextran permeability assay
The permeability assay was performed as described in (11,14). Mice were anaesthetized with isoflurane and administered 40 µl FITC-dextran (10 mg/kg body weight) intranasally. After a 30-minute wait to allow FITC-dextran to circulate in the blood, blood was collected via cardiac puncture, and fluorescence intensity was determined using a spectrophotometer.
Cytospins
Collected BALF and harvested fibroblasts were centrifuged at 570 x g for 5 minutes, and the cells were suspended in 1 ml of PBS solution and fixed onto slides at 570 rpm for 4 minutes on a Cytospin 2 (Shandon).
Statistical Analysis
All statistical calculations were performed using Graphpad Prism. Mann-Whitney test was used to determine significance. A P value of less than 0.05 was considered significant.