Cell culture
The human pancreatic ductal adenocarcinoma (PANC-1) cell line was maintained in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal bovine serum (FBS) and 1% sodium pyruvate. Stable knockdown of IFT88 (shIFT88#3) was generated in PANC-1 cells via the lentiviral delivery of shRNA against IFT88 (#3; clone TRCN0000141713; RNAi core lab of Genomics Research Center, Academia Sinica, Taipei, Taiwan). Stable cells were selected with puromycin (1 μg/ml). To establish cisplatin-resistant pancreatic cancer cells, PANC1 cells were initially treated with a low dose of cisplatin (0.5 μM) for one month and then the dose of cisplatin was gradually increased to 1, 2 and 4 μM (each dose for one month of incubation). The culture medium of RPMI-1640 with cisplatin was changed every two days. CPT-resistant PANC-1 cells were maintained in 4 μM cisplatin-containing culture medium. All the cell lines were cultured at 37 °C in a humidified atmosphere of 5% CO2. These cells were regularly examined for mycoplasma contamination by immunofluorescence staining and immunoblotting assays according to published methods [39].
Drug treatments
Cisplatin (CPT; 232120; 5 μM), gemcitabine (GEM; G6423; 100 μM), etoposide (ETO; E1383; 100 μM), hydroxyurea (HU; H8627; 1 mM), paclitaxel (Taxol; T7402; 0.1 μg/ml), roscovitine (Rosco; R7772; 20 μM), Ku55933 (ATMi; SML1109; 10 μM), Akt inhibitor IV (Akti; 124011; 5 μM), p53 inhibitor (p53i; pifithrin-α; 506170; 10 μM), Chk1 inhibitor (Chk1i; UCN-01; 10 μM), Chk2 inhibitor II (Chk2i; 220486; 10 μM), caffeine (C0750; 2 mM), sodium orthovanadate (SOV; S6508; 1 μM) and SBI-0206965 (ULK1i; SML1540; 10 μM) were purchased from Sigma, St. Louis, MO. Berzosertib (ATRi; VE-822; 100 nM) and dorsomorphin (AMPKi; S7306; 5 μM) were purchased from Selleck Chemicals, Houston, USA. Bafilomycin-A1 (Baf. A1; 196000; 10 nM) was purchased from Enzo, NY, USA. Chloroquine (CQ; NBP2-29386; 100 μM) was purchased from Novus Biologicals (Littleton, CO, USA).
Antibodies
The following antibodies were obtained commercially:
Anti-Ku70 (N3H10; GTX23114), anti-Ku80 (GTX109935), anti-ATM (2C1; GTX70103), anti-ATR (GTX128146), anti-β-actin (AC-15; GTX26276), anti-β-tubulin (GTX101279), anti-DNA-PKcs (phospho-Thr2609; GTX24194), anti-p53 (DO1; GTX70214), anti-Akt (phospho-Ser473; GTX128414), and anti-p53 (GTX70214) were purchased from GeneTex (Irvine, CA); anti-acetylated-tubulin (T6793), anti-γ-tubulin (T6557), and anti-ATG7 (A2856) were purchased from Sigma (St. Louis, MO); anti-ATM (phospho-Ser1981; ab81292), anti-CP110 (ab99338), and anti-BBS4 (ab197122) were purchased from Abcam (Cambridge, UK); anti-IFT88 (13967-1-AP), anti-ARL13B (17711-1-AP), and anti-AZI1 (25735-1-AP) were purchased from Proteintech (Chicago, IL); anti-ULK1 (phospho-Ser757; #6888), anti-ULK1 (D8H5; #8054), anti-AMPK (phospho-Thr172; 40H9; #2535), anti-AMPK (#2532), anti-ATR (phospho-Ser428; #2853), anti-LC3A/B (D3U4C) XP (#12741), anti-PCM1 (Q15; #5259), anti-Chk2 (phospho-Thr68; #2661), anti-Chk2 (#3440), anti-Akt (phospho-Ser473; #4060), anti-Akt (#4691), anti-p44/42 MAPK (Erk1/2; phospho-Thr202/Tyr204; #4370), anti-p44/42 MAPK (Erk1/2; #4695), anti-p53 (phospho-Ser15; #9284), anti-Chk1 (phospho-Ser317; #12302), and anti-Chk1 (#2360) were purchased from Cell Signaling (Beverly, MA, USA); anti-OFD1 (NBP1-89355) and anti-CEP164 (NBP1-81445) were purchased from Novus (Littleton, CO); anti-p150glued (610473) was purchased from BD Biosciences, Mississauga, ON, Canada.
Immunofluorescence microscopy
Cells were fixed with ice-cold methanol at −20 °C for 5 min. After washing with PBS, the cells were blocked with 5% BSA for 1 hour at room temperature, followed by incubation with primary antibodies at 4 °C for 12 hours. Next, the cells were washed with PBS three times. After that, the cells were incubated with fluorescein isothiocyanate-conjugated or Cy3-conjugated secondary antibodies at room temperature for one hour in the dark. The nuclei were stained with 6-diamino-2-phenylindole (DAPI; 0.1 μg/ml) simultaneously. After washing with PBS three times, the coverslips were overlaid and mounted on glass slides in 50% glycerol. Prepared cells were observed using an Axio imager M2 fluorescence microscope (Zeiss, Switzerland) and captured using ZEN pro software (Zeiss, Switzerland). 3D images of excessive formation of centriolar satellites were generated using Imaris software (Zurich, Switzerland).
RNA interference (RNAi)
IFT88, CEP164, PCM1, p150glued, ATM, ATR, DNA-PKcs, CHEK1, CHEK2 and AKT were depleted in human PANC-1 and cisplatin-resistant PANC-1 cells using annealed siRNAs with the following target sequences:
siIFT88: 5′-cgacuaagugccagacucauu [dt] [dt]-3′ [40]
siCEP164: 5′-caggugacauuuacuauuuca [dt] [dt]-3′ [41]
siPCM1: 5′-ggcuuuaacuaauuaugga [dt] [dt]-3′ [42]
sip150: 5'-gccuugaacaguuccauca [dt] [dt]-3' [43]
siATM: 5′-aacauacuacucaaagacauu [dt] [dt]-3′ [44]
siATR: 5′-aaccuccgugauguugcuuga [dt] [dt]-3′ [44]
siDNA-PKcs: 5′-gggcgcuaaucguacugaa [dt] [dt]-3′ [45]
siCHEK1: 5'-ucgugagcguuuguugaac-[dt][dt]-3' [46]
siCHEK2: 5′-aagaaccugaggaccaagaac [dt] [dt]-3′ [46]
siAKT: commercially available from Cell Signaling (Cell Signaling Technologies; #6211)
Scrambled siRNA: 5′-gaucauacgugcgaucaga [dt] [dt]-3′ (Sigma, St. Louis, MO).
For siRNA transfection, 6 μl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was mixed with 500 μl of Opti-MEM (Life Technologies, Grand Island, NY) for 5 min and then 2 μl of siRNA (100 μM in stock) in 500 μl of Opti-MEM was added to this mixture, which was then incubated at room temperature for 20 min before being layered onto cells in 1 ml of RPMI-1640 (100 nM working concentration). PANC-1 cells were harvested for further Experiments 72 h after transfection.
For shRNA transfection, lentiviruses were transfected into PANC-1 cells via the lentiviral delivery of three different anti-ATG7 shRNAs:
ATG7#1: TRCN0000007584, GCCTGCTGAGGAGCTCTCCAT
ATG7#2: TRCN0000007586, GCTTTGGGATTTGACACATTT
ATG7#3: TRCN0000007587, CCCAGCTATTGGAACACTGTA
All the lentiviruses were purchased from the RNAi core lab of Genomics Research Center, Academia Sinica, Taipei, Taiwan.
Quantitative Reverse Transcription PCR
RNA samples were extracted from the cultures using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed using the high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA) using 2 μg of total RNA. The resulting cDNA was used for real-time quantitative PCR (qPCR) using Fast SYBR Green Master Mix (Applied Biosystems, Waltham, MA) and StepOnePlus (Applied Biosystems, Waltham, MA). The relative abundance of specific mRNAs was normalized to human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA as the internal control. The qPCR primer sequences were as follows:
KIF7(F): AACGGCTCTGTGGTCAGC.
KIF7(R): AGCACCTTCTCCATCTCCTG.
SCLT1(F): AGAGAACTGTGGGCTTGTCA.
SCLT1(R): CTCCAGGGCAATCTTCCTTA.
IFT43(F): AGATTTGGGGCTGGCTTC.
IFT43(R): CAGGTCACGGTAGGTCATCA.
RNF38(F): ATCTCCCTTACGCACAGCAG.
RNF38(R): TGGATGAGCAGCAGGATGTA.
TOPORS(F): GATTGCCCTGCTCCTTCATA.
TOPORS(R): TGGTGCCTGACTAACAGTGG.
C5orf30(F): ATTTGGTTGGCTTCACGACT.
C5orf30(R): GGCTTCTGCTTTGCTCTCTT.
GAPDH(F): AAGGTCGGAGTCAACGGATTTG.
GAPDH(R): CCATGGGTGGAATCATATTGGAA.
Western blotting
Cells were lysed using the CelLytic TM M cell lysis reagent (Sigma, St. Louis, MO) with protease cocktail inhibitors (Roche, Mannhein, Germany) on ice for 10 minutes. Next, the lysates were centrifuged at 13,300 rpm for 10 minutes at 4 °C. The cell lysates were collected and quantified using the Bradford protein quantity assay (Bio–Rad, Hercules, CA, USA). The quantified lysates were mixed with sample buffer and heated at 100 °C for 20 minutes. Next, the prepared samples were loaded on gels and separated by SDS–PAGE. After gel separation, the samples were transferred to PVDF membranes at 20 V for 720 min in a cold room. After washing with TBST, the membranes were blocked with 3% BSA in TBST at room temperature for 1 hour. Next, the membranes were incubated with primary antibodies at 4 °C for 12 hours. Following extensive washing with TBST three times, the membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 1 hour. After washing with TBST three times, the signals were detected by ECL™ Detection Reagents.
Statistical analysis
All the results were presented as means ± S.D. from at least three independent experiments, and more than 500 cells were counted in each individual group. The error bars in bar plots represent the standard error of the mean from at least three independent experiments. Differences between two groups were compared using unpaired two-tailed t-tests and ANOVA for multigroup comparisons, for which a P value < 0.05 was considered statistically significant.