Investigation of Biodesulfurization by A Novel Pseudomonas Strain and the Underlying Metabolic Mechanisms

doi:10.21203/rs.3.rs-943658/v1

Download PDF

Research Article

Investigation of Biodesulfurization by A Novel Pseudomonas Strain and the Underlying Metabolic Mechanisms

https://doi.org/10.21203/rs.3.rs-943658/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The increasing public expectations for good air quality have necessitated the development of biodeodorization technology. In this study, a novel heterotrophic Pseudomonas strain was isolated from biogas slurry and its biodesulfurization ability was investigated. The optimization of culture conditions determined 30 ℃ and 200 rpm as the optimal temperature and shaking speed. Under such conditions, 50 mM thiosulfate was completely consumed. The whole genome sequencing and functional annotation identified the genes associated with sulfur metabolism and the RT-qPCR analysis quantified the expression level of corresponding genes. The results showed that this strain was able to convert thiosulfate to sulfane, which could be decomposed into elemental sulfur and therefore achieved desulfurization. However, this process was relatively weak as most thiosulfate was converted into soluble tetrationate catalyzed by gene tsdA. Further research would focus on the enhancement of sulflane production pathway through metabolic engineering tools.

Environmental Policy

Biodesulfurization

Metabolic pathway

Pseudomonas

RT-qPCR

Tetrationate

Sulfane sulfur

The fast development of society has promoted diverse demand on public welfare, humanistic care, and environmental quality. Among that, an increasing public expectation on air quality has emerged nowadays and extensive efforts are being made to provide nuisance-free breathable air for people’s daily life (Li et al. 2015). The malodorous pollutants generated from industrial production, livestock and poultry production, wastewater treatment plant, and etc. would bring undesirable feelings, and some of them would further cause unfavorable effects towards health of human and living organisms (Yun and Seo 2013; Wysocka et al. 2019). To solve this issue, different technologies have been developed to reduce the impacts of odorants in terms of preventing occurrence, blocking emission and efficient degradation (Wysocka et al. 2019). For odorants degradation, physical methods (combustion) and physio-chemical methods (absorption, adsorption, and membrane separation) employed the characteristics of odorants to achieve the effective removal, with the advantages of wide application spectrum, high efficiency and stability. However, the operation cost of such processed is generally high (Zhuo et al. 2019). The possible production of secondary pollutants and regeneration of sorbents are also drawbacks to be overcome (Matusiak et al. 2016).

Biological deodorization uses microorganisms to degrade odorous pollutants (e.g., H₂S, NH₃, amine and etc.) under relatively mild conditions. In comparison, it has lower environmental impact and is more cost-efficient than physicochemical techniques (Cano et al. 2018). There are three major types of reactor including biosrubber, biofilter and biotrickling filter (Mudliar et al. 2010). For example, Huan et al. (Huan et al. 2021) utilized biotrickling filter packed with different materials to treat high-concentration of H₂S. Packing with pine bark showed the highest removal rate of 86.31% under the loading rates of 53.59 g/m³⋅h and the empty bed residence time (EBRT) of 40.5 s. Cano et al. (Cano et al. 2019) also achieved successful desulfurization of biogas by using anoxic biotrickling filter to remove H₂S. The key of success relies on the functional microorganisms which can degrade odorous pollutants and convert them into products without unpleasant smell. A complex microflora was usually preferred. Such microbial community usually consists of species with different functions such as biotransformation, biofilm formation, and attachment, and indicates the better treatment performance and stability (Pokorna and Zabranska 2015). Sulfur-oxidizing bacteria as the core microorganisms have been proven to be responsible for the oxidization of H₂S into sulfate and elemental sulfur. Those species are mainly lithotrophs and phototrophs which can use sulfide as electron donor for their photosynthetic and respiratory energy-generating systems (Gholipour et al. 2018). On the other hand, such autotrophic sulfur oxidizer would encounter the bottleneck of slow growth and low cell mass which may limit the efficiency of biodesulfurization. The screening of powerful sulfur-oxidizing microbes, especially the chemoheterotrophic species, could overcome the abovementioned drawbacks and therefore improve the performance of biodesulfurization system (Meyer et al. 2007). However, rare study has been performed on this aspect (Feng et al. 2018).

In this study, a heterotrophic Pseudomonas strain isolated from biogas slurry was investigated on its biodesulfurization ability for the first time. Sodium thiosulfate was used as its one sulfur atom was regarded to have a valence of -2 and has been widely used for the screening of sulfide removing microorganisms (Yang et al. 2015). The cultivation temperature and shaking speed were optimized aiming to improve both cell growth and thiosulfate conversion. To illustrate the specific process of thiosulfate conversion and the associated metabolic pathways, the whole genome of this strain was sequenced and functionally annotated. The related genes were identified and their expression level was analyzed through quantitative PCR. These results would provide insight for the underlying mechanisms of biological desulfurization by this novel strain. They would also provide guidance for the development of diverse tools and techniques to improve the biodesulfurization performance, such as gene expression manipulation, metabolic pathway redesign, and key enzyme isolation and immobilization. Broader practical applications (e.g. bioaugumentation of desulfurization in biofilters) are expected with the aid of those knowledge and tools.

2.1 Microorganism enrichment, isolation and idenfication

The biogas slurry sample was collected from Shanghai Liming Resources Recycling Co., LTD, Shanghai city, PR China. Firstly, 1 mL slurry sample was incubated in 50 mL liquid medium on a rotary shaker with 200 rpm at 30℃. The liquid enrichment medium contained 50.0 mmol/L Na₂S₂O₃, 1.0 g/L K₂HPO₄, 0.25 g/L KH₂PO₄, 0.2 g/L MgCl₂, 2.0 g/L NH₄Cl, and 10.0 g/L glucose. The pH was adjusted to 6.8. Every 48 h, 1 mL microbial suspension was subcultured into fresh enrichment medium and the conditions were maintained consistent. After 4 cycles of enrichment, serial dilution was adopted to isolate the strain on solid medium (liquid enrichment medium supplemented with 1% agar powder). The isolation process was repeated 3 times to ensure the purity of isolates and the single colony was inoculated into fresh liquid medium and the consumption of sodium thiosulfate was tested. The one isolate with the best growth and thiosulfate removal performance was selected and used for further investigation.

The genomic DNA of selected isolate was extracted with AxyPrep™ Bacterial Genomic DNA Miniprep Kit (AP-MN-BT-GDNA-50, AXYGEN) following the manufacture’s instruction. The 16S rDNA sequence was amplified by polymerase chain reaction (PCR) with KOD-plus-neo enzyme (KOD-401, TOYOBO) and primer pair of 27F (5’-AGAGTTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’). The PCR product was purified and sequenced by Sangon Biotech Co., Ltd., (Shanghai, China). The sequence acquired was compared with that of other microorganisms in GenBank by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.2 Optimization of cultivation conditions

To improve the biodesulfurization ability, the effects of cultivation conditions (temperature and shaking speed) were investigated. The seed culture was prepared with LB medium (tryptone 10.0 g/L, yeast extract 5.0 g/L, NaCl 10.0 g/L) under standard conditions (pH=6.8, temperature=30 ℃ and shaking speed=200 rpm), and inoculated into growth medium which was the same as liquid enrichment medium. Different temperatures (20 ℃, 25 ℃, 30 ℃, 35 ℃ and 42 ℃) and shaking speeds (100 rpm, 150 rpm, 200 rpm and 250 rpm) were applied, while other parameters were consistent with standard conditions. The cultivation process lasted for 28 h. Samples were taken at different time points during culture and centrifuged at 12000 g for 10 min. The cell mass was resuspended in sterilized water and the optical density at 600 nm was measured by a UV-Vis spectrometer (DR2800, HACH, USA) to monitor cell growth. The supernatant was collected to analyze the consumption of thiosulfate, generation of tetrationate and sulfane sulfur. All treatments were performed in triplicate.

2.3 Analytical techniques

The concentration of thiosulfate was measured by using high performance liquid chromatography (HPLC) system (SCL-10Avp, Shimadzu, Japan) equipped with an electrical conductivity detector (CDD-10Avp, Shimadzu, Japan) and an anion exchange column (IC-A3, Shimadzu, Japan) (Mu et al. 2021). The mixture solution of 8 mmol/L p-Hydroxybenzoic acid, 3.2 mmol/L Bis-Tris and 50 mmol/L boric acid was used as the mobile phase, running at a flow rate of 1.0 mL/min. The column temperature was maintained at 40 ℃.

The concentration of tetrathionate was also measured by the same HPLC system and IC-A3 column, while with an UV detector (CDD-10Avp, Shimadzu, Japan) (Bak et al. 1993). The compounds were eluted with a elution of 40% mobile phases A and 60% mobile phases B at a flow rate of 1.0 mL/min. Solvent A consisted of deionized water and 50 mmol/L NaCl (ACS regent, purity ≥99%), and solvent B consisted of methanol (HPLC grade) and acetonitrile (HPLC grade) in a ratio of 1: 5. The column temperature was also maintained at 40 ℃ and the signal was monitored at 230nm.

The concentration of sulfane sulfur was determined by fluorescence reaction with SSP4 (PB10, DOJINDO) (Ikeda et al. 2017)(Olson et al. 2018). The total volume of reaction system was 100 µL, containing 80 µL DMSO, 10 µL 0.1mmol/L SSP4 solution, and 10 µL sample. After incubation at room temperature for 10 min, the fluorescence intensity was measured at 515 nm (λex=482nm) by a fluorophotometer (Synergy H1, BioTek, US). Potassium polysulfide (12665, Sigma) was used to construct the standard curve and the sulfane sulfur concentration was expressed as potassium polysulfide equivalent.

2.4 Genome sequencing

The whole-genome sequencing was performed by Grandomics Biosciences Co., Ltd, Wuhan, PR China. The genomic DNA was prepared by the CTAB method and followed by purification with QIAGEN Genomic kit (13343, QIAGEN). The NEBNext Ultra II End Repair/dA-tailing Kit (E7546, NEB) and adapter in the ligation library construction kit (SQK-LSK109, Oxford Nanopore Technologies) were used for constructing sequencing library, and then the libraries were launched on a Nanopore PromethION sequencer instrument (Oxford Nanopore Technologies, UK). The sequenced data were assembled and aligned by NextDenovo (https://github.com/Nextomics/NextDenovo) / NextPolish (https://github.com/Nextomics/NextPolish). Genes were predicted from the assembled scaffolds using the Prodigal software with default parameters. The Gene ontology (GO) annotations of predicted genes were determined by the Blast2GO program, and the corresponding function annotation was completed by blasting genes against Kyoto Encyclopedia of Genes and Genomes (KEGG) databases (http://www.genome.jp/kegg/). The genome has been deposited in the NCBI database with the accession number SAMN21246304.

2.5 Analysis of gene expression level

For gene expression analysis, samples were taken every 2 h starting from 4 h. Cells were collected by centrifugation at 12,000 g for 10 min at 4 ℃. Total RNA was extracted from collected cells with TaKaRa MiniBEST Universal RNA Extraction Kit (RR037A, TaKaRa) according to the manufacturer’s instruction. The concentrations of RNA samples were determined with the spectrophotometer (NanoDrop 2000C, ThermoFisher Scientific, USA). Only samples with the 260/280 value between 1.9~2.1 and 260/230 value greater than 2.0 were used for further analysis. The integrity of RNA samples was assessed by agarose gel electrophoresis. The cDNA synthesis was performed at 37℃ for 15 min using PrimeScript™ RT reagent Kit (RR047A, TaKaRa) following the manufacturer’s instructions. Prior to reverse transcription, the possible DNA contamination was removed by gDNA Eraser at 42℃ for 2 min.

Based on the whole genome sequencing and annotation, genes related to sulfur metabolism were selected including glpE, tsdA, TST1, TST2, cysJ1, cysJ2, cysI, SQR, cysM, cysK, SOD1, SOD2, iscS1, and iscS2. The expression level of those related genes were analyzed by RT-qPCR. The primers sequences and annealing temperature of the target genes and 16S rRNA as reference gene were listed in Table 1. The reliability of each primers pair was checked using genomic DNA as template. The 20 µL RT-qPCR reaction mixtures contained 10 µL TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (RR420A, TaKaRa), 0.4 µL ROX Reference Dye II, 0.4 µL each of 10 µM forward and reverse primers, 1.0 µL cDNA template (the amount of template in mixture is less than 100 ng), and 7.8 µL ddH2O. Controls with no template were also performed for each primer pair. The RT-qPCR amplified reactions were conducted using a LightCycler 96 real-time fluorescent quantitative PCR instrument (QuantStudio™ 7 Flex, ThermoFisher Scientific, USA) with the following program: denaturing at 95 ℃ for 30 s (holding stage), followed by 40 cycles (95 ℃ for 5 s and 60 ℃ for 34 s; PCR stage) and a final extension step (95 ℃ for 15 s and 60 ℃ for 1 min; melting curve stage). Each gene was analyzed in triplicate and the relative expression level calculated by the 2^−ΔΔCt method. The values of standard conditions (no thiosulfate addition) at 4 h were used as baseline.

Table 1

Primers and annealing temperature of the target genes
Genes	Primers	Sequences (5’-3’)	Annealing temperature (℃)
glpE	forward	CGTGAGCAAGGTGCGGTGGTCGT	60.0
glpE	reverse	CTCTGGCTGGAGTTGCCGTGGTA	60.0
TST1	forward	GGGCGCTTCATCTGGTTGCTCG	55.0
TST1	reverse	CCAGTCGGCTTTGCAGGTATTCG	55.0
TST2	forward	GGACATGAAGCTGCTGATCGACGCC	55.0
TST2	reverse	AGTTGGTCCGCAGGCAGGAAACG	55.0
cysJ1	forward	TGGGTTATGCGGATGGGTTCG	55.0
cysJ1	reverse	AACGGGCTGCGGTCATTGTCG	55.0
cysJ2	forward	GTTCTACCTGCTGTTCGCCCTCACCG	55.0
cysJ2	reverse	TTGGCCCAGATCGCGTCGTAGTCG	55.0
cysI	forward	CCGGTGAGCTGAGCGAAGAAGAAT	60.0
cysI	reverse	TGGCGGGTACTGATGTGGGCGTA	60.0
sqr	forward	CCAGCCGCCGATGCCAATCAAGT	55.0
sqr	reverse	CGCTACCAGGCGATGGGAATAGTTGA	55.0
cysM	forward	GCCCGAGCAATACCTGCCGAAGA	60.0
cysM	reverse	AGCATGGCTGCAACCGCACCAC	60.0
cysK	forward	CCAAGATCGAAGGGCGTAACCCA	60.0
cysK	reverse	GCATGGTCAGGAGCAGCTTGTAG	60.0
SOD1	forward	TGCACCAGCGCCCCTCGTGCGA	55.0
SOD1	reverse	CCTTGAAGTCCTCTGTCTTGAGC	55.0
SOD2	forward	CCTGGAGTATCACCACGACAAGC	60.0
SOD2	reverse	TGTTGAAGATGCCACCCGAAGA	60.0
iscS1	forward	GCAGCCGGGCCACCTGATCACCA	60.0
iscS1	reverse	TTGACCGCCATCAGCGACACCAG	60.0
iscS2	forward	AGACCAAGGGCAAGCACATCATCAC	60.0
iscS2	reverse	TCGAGCCGACTTCGTTGTTCACG	60.0
tsdA	forward	CGGTGGGCAATGGCATGAACT	55.0
tsdA	reverse	TGGATACGCTCGGCGAAGGTG	55.0
16S rRNA (Liang et al. 2021)	forward	CCTACGGGAGGCAGCAG	58.0
16S rRNA (Liang et al. 2021)	reverse	ATTACCGCGGCTGCTGG	58.0

3.1 Screening of an effective thiosulfate removing strain

The enrichment process obtained 5 isolates. The results of cell growth and thiosulfate removal were shown in Table 2. Among the obtained 5 isolates, P1 showed the highest OD₆₀₀ value and thiosulfate removal percentage and was selected for further investigation. The 16S rDNA sequencing has confirmed P1 strain as Pseudomonas sp.

Table 2

The results of thiosulfate removing strain isolation
isolates	P1	P2	P3	P4	P5
OD₆₀₀	6.11	3.25	4.68	5.28	4.32
Na₂S₂O₃ removal (%)	92.81	38.22	75.42	62.18	59.36

3.2 Optimization: temperature and shaking speed

To further improve cell growth and thiosulfate conversion performance of P. sp. P1, the culture conditions were optimized in terms of temperature and shaking speed (Fig. 1 & Fig. 2). Temperature has been proven to be an important factor to affect the growth and metabolic activity of microorganisms (Farrell and Rose 1967). In the tested range of temperature, a fast increase of OD₆₀₀ value was observed at 25 ℃ and 30 ℃ (Fig. 1a). Culture at 25 ℃ achieved a slightly higher OD₆₀₀ value than 30 ℃. Lower or higher temperature exhibited adverse effects on cell growth, indicated by slower growth rate and lower maximum OD₆₀₀ value. Especially, when the temperature was elevated to 42 ℃, limited cell growth was observed. The possible reason for that was the high temperature would cause the deactivation of microbial enzymes and even cell death (Farrell and Rose 1967). The conversion of thiosulfate showed similar results (Fig. 1b). During cultivation at 20~37 ℃, effective conversion of thiosulfate by P. sp. P1 was observed as the concentration of thiosulfate in medium kept decreasing. Culture at 30 ℃ showed the highest conversion rate, followed by 25 ℃ and 37 ℃. After 16 h, the residual thiosulfate concentration dropped to 0 mM. A large portion of consumed thiosulfate flew into tetrationate (13~16 mM S₄O₆²⁻), and 600~800 mg/L sulfane (equivalent to around 4.5~6.0 mM K₂S₂) was produced at 25~37 ℃ (Fig. 1c). The only exception was 42 ℃. Thiosulfate was barely consumed, which was consistent with the limited cell growth and tetrationate/sulfane concentrations at this temperature. Based on the results, 30 ℃ was selected as the optimal culture temperature in the following experiments.

As a kind of aerobic species, the growth and metabolism of P. sp. P1 would also be influenced by the concentration of dissolved oxygen. Agitation during cultivation would prompt the diffusion of oxygen from air into medium and higher shaking speed generally resulted in higher dissolved oxygen level. In this study, the different shaking speeds mainly affected cell growth rate (Fig. 2a). Higher cell growth rate was observed at higher shaking speed. However, limited differences on maximum OD₆₀₀ value and thiosulfate consumption rate were exhibited (Fig. 2a&(Fig. 2b). As for the products of thiosulfate conversion, the concentrations of tetrationate at different shaking speeds exhibited similar level. A slightly higher concentration of sulfane (800 mg/L, equivalent to 5.77 mM K₂S₂) was observed at 200 rpm (Fig. 2c). Based on the above results, 200 rpm was selected in the subsequent work.

3.3 Genome sequencing and functional annotation

The genome sequencing of P. sp. P1 generated raw data of 3,306,084,221 bps. After quality control and filtering, 152,860 reads were kept with average length of 21,619 bp and N50 length of 30,530 bp. The assembly of all filtered reads yielded two contigs, with length of 5,227,381 bp and 337,874 bp respectively. The overall GC content of assembly was observed as 63.05%. Totally 5,125 genes were predicted, accounting for 87.64% of genome.

Gene ontology (GO) annotations were used to classify the functions of the predicted genes. GO mapping also provided ontology of gene product properties, which are grouped into three main domains: biological process, molecular function, and cellular component (Fig. 3a). The GO distribution of the predicted genes was found to be highest for molecular function (2,540 genes), followed by biological process (2,465 genes) and cellular component (930 genes). Genes associated with different metabolic functions were annotated with Kyoto Encyclopedia of Genes and Genomes (KEGG) database and the classification was visualized in Fig. 3b. In total, 2,752 genes were located into different pathways. Genes related to metabolism constituted the largest proportion (897 genes), including amino acid metabolism, carbohydrate metabolism, and metabolism of cofactors and vitamins. Environmental information processing was the second largest category (399 genes), followed by Cellular process (283 genes) and Genetic information processing (204 genes).

3.4 Construction of sulfur metabolic pathway

The gene annotation analysis of P. sp. P1 revealed the presence of multiple genes involved in the sulfur metabolism. The corresponding metabolic network was constructed in Fig. 4. The entire network can be divided into two sections: organic part and inorganic part. In the inorganic part, S₂O₃²⁻ can be converted into SO₃²⁻ by thiosulfate sulfurtransferase (glpE) or thiosulfate/3-mercaptopyruvate sulfurtransferase (TST1, TST2) (Kohlmeier 2015). The SO₃²⁻ would be further reduced to H₂S by sulfite reductase, including the flavoproteins (cysJ1, cysJ2) and hemoprotein (cysI) (Tavolieri et al. 2019). In addition, thiosulfate dehydrogenase (tsdA) can catalyze the formation of a sulfur-sulfur bond between two thiosulfate (S₂O₃²⁻) molecules to produce tetrationate (S₄O₆²⁻) (Brito et al. 2015). The H₂S can be used to synthesize cysteine, a kind of sulfur-containing amino acid, by cysteine synthase (cysM and cysK) (Kredich and Tomkins 1966). It can also be polymerized to form sulfane sulfur (e.g. persulfides and polysulfides), with the aid of sulfide:quinone oxidoreductase (SQR) (Cherney et al. 2012) or superoxide dismutase (SOD1, SOD2 )(Olson et al. 2018). Cysteine desulfurase (iscS) can catalyze the decomposition of cysteine into alanine and sulfane sulfur (Schomburg et al. 2008). The produced sulfane sulfur could be subsequently incorporated into the biosynthetic pathways of sulfur-containing biofactors such as thiamine, biotin and lipoic acid (Mander and Liu 2010). Excessive sulfane could be decomposed and release elemental sulfur (S⁰) (Xuan et al. 2020).

3.5 Gene expression analysis of sulfur metabolism

Based on the metabolic pathway in Fig. 4, RT-qPCR analysis was performed to evaluate the expression of related genes. Analysis using genomic DNA as template confirmed the presence of interested genes and normal function of each primer pair (Table 3), while only TST1, cysI, tsdA, cysM, cysK, SOD2, iscS1 and iscS2 were detected at the transcriptional level. The gene expression results were expressed in relative to that of standard culture (without thiosulfate addition) at 4 h. The addition of thiosulfate elevated the expression level of all related genes to different extents (Fig. 5). An active gene expression for sulfur metabolism was observed between 4-8 h, in agreement with the complete consumption of thiosulfate within 8-h cultivation. The gene tsdA was improved the most, whose expression level increased more than 50 folds. This gene would be responsible for the efficient conversion from thiosulfate to tetrationate. The expression levels of TST1 and cysI were relatively low, leading to limited conversion from thiosulfate to sulfite and H₂S. These results were consistent with previous results that most thiosulfate was converted into tetrathionate, and a small portion into sulfane with SO₃²⁻ and H₂S as intermediates. For organic part, genes SOD2 and iscS1 contributed to the production of sulfane from H₂S and cysteine respectively. Compared to standard conditions, their expression levels were elevated by more than 4 folds. The expression level of cysK, cysM and iscS2 was comparatively low and kept decreasing. From 8-12 h, all genes showed a reduced expression level.

The general process of biodesulfurization includes two steps: transferring of gaseous H₂S into liquid phase and biological degradation by microorganisms (Huan et al. 2021). The partial oxidation of sulfide to elemental sulfur (S⁰) is preferred as sulfur can be easily removed separated and removed from reaction mixture (González-Cortés et al. 2021). In this study, the major direction of sulfur metabolism inside P1 was to produce tetrationate, catalyzed by gene tsdA. Tetrationate was still soluble and the effective biodesulfurization cannot be achieved with tetrationate as major product. Only about 10% of initially added sulfur was converted into sulfane. The distribution of sulfur was primarily determined the activity level of gene expression in different metabolic pathways. According to Fig. 4, a complex sulfur metabolic network containing diverse pathways was observed based on the whole genome sequencing. There are two possible pathways for thiosulfate conversion. The first one is thiosulfate-tetrationate pathway, and the second one is thiosulfate-sulfite-sulfide-sulfane pathway. P. sp. P1 was able to utilize the second thiosulfate conversion pathway to produce sulfane, which could be decomposed into elemental sulfur with excessive amount and achieve biodesulfurization. However, the expression level of related genes (e.g. TST, cysJ, cysI and SOD) was relatively low which limited the sulfane production. Instead, the highly active gene tsdA made the thiosulfate-tetrationate pathway outcompete another one, leading to the generation of large amount of tetrationate. The redirection of sulfur metabolism would be a feasible strategy to improve the biodesulfurization of P. sp. P1. From the point of practical application, further research would be performed using H₂S as substrate.

Table 3

The Ct value of selected genes using genomic DNA as template
Genes	Ct mean	Ct SD
glpE	17.057	0.216
TST1	17.677	0.206
TST2	17.541	1.138
cysJ1	16.906	0.298
cysJ2	17.961	0.953
cysI	17.723	0.694
SQR	17.130	0.331
cysM	17.635	0.686
cysK	17.435	0.346
SOD1	18.228	1.052
SOD2	18.56	0.467
iscS1	17.42	0.325
iscS2	17.055	0.106
tsdA	17.05	0.566

To conclude, this newly isolated strain P. sp P1was able to achieve efficient thiosulfate removal during cultivation. Temperature affected both cell growth and thiosulfate conversion efficiency and 30 ℃ was determined as the optimal value. Variations of shaking speed could influence the dissolved oxygen level in medium and therefore affected the cell growth rate. As a preferred product form for biodesulfurization, sulfane was produced with sulfite and H₂S as possible intermediates. Due to the relatively low expression level of related genes, the final sulfane concentration was much lower compared to tetrationate. The competition between different metabolic pathways for thiosulfate conversion resulted in the distribution of different final products. Further research efforts need to be made for metabolic network redesign.

Ethics approval Not applicable

Consent to participate Not applicable.

Consent for publication Not applicable.

Author contributions

D. W., L. L.and X. L. designed the research; D. W. conducted the research; X. L. wrote the paper; J. S., L. L., X. C. and W. Y. revised the paper; D. W. had primary responsibility for final content. All authors read and approved the final manuscript.

Funding

This work was supported by the STS Project of Fujian Provincial and Chinese Academy of Sciences (Grant No. 2020T3032); the National Natural Science Foundation of China (Grant No. 21908237); the Youth Innovation Promotion Association CAS (Grant No. 2021288); the Shanghai Agriculture Applied Technology Development Program, China (X20190302); and the Shanghai Engineering Research Center of Biotransformation of Organic Solid Waste（Grant No. SERC2021C02）.

Competing Interest The authors declare that they have no competing interests.

Availability of data and materials

Data are available on request to the authors.

Bak F, Schuhmann A, Jansen K-H (1993) Determination of tetrathionate and thiosulfate in natural samples and microbial cultures by a new, fast and sensitive ion chromatographic technique. FEMS Microbiol Ecol 12:257–264
Brito JA, Denkmann K, Pereira IAC et al (2015) Thiosulfate Dehydrogenase (TsdA) from Allochromatium vinosum: Structural and Functional Insights into Thiosulfate Oxidation*. J Biol Chem 290:9222–9238. https://doi.org/https://doi.org/10.1074/jbc.M114.623397
Cano PI, Brito J, Almenglo F et al (2019) Influence of trickling liquid velocity, low molar ratio of nitrogen/sulfur and gas-liquid flow pattern in anoxic biotrickling filters for biogas desulfurization. Biochem Eng J 148:205–213. https://doi.org/https://doi.org/10.1016/j.bej.2019.05.008
Cano PI, Colón J, Ramírez M et al (2018) Life cycle assessment of different physical-chemical and biological technologies for biogas desulfurization in sewage treatment plants. J Clean Prod 181:663–674. https://doi.org/https://doi.org/10.1016/j.jclepro.2018.02.018
Cherney MM, Zhang Y, James MNG, Weiner JH (2012) Structure–activity characterization of sulfide:quinone oxidoreductase variants. J Struct Biol 178:319–328. https://doi.org/https://doi.org/10.1016/j.jsb.2012.04.007
Farrell J, Rose A (1967) Temperature Effects on Microorganisms. Annu Rev Microbiol 21:101–120. https://doi.org/10.1146/annurev.mi.21.100167.000533
Feng S, Lin X, Tong Y et al (2018) Biodesulfurization of sulfide wastewater for elemental sulfur recovery by isolated Halothiobacillus neapolitanus in an internal airlift loop reactor. Bioresour Technol 264:244–252. https://doi.org/https://doi.org/10.1016/j.biortech.2018.05.079
Gholipour S, Mehrkesh P, Azin E et al (2018) Biological treatment of toxic refinery spent sulfidic caustic at low dilution by sulfur-oxidizing fungi. J Environ Chem Eng 6:2762–2767. https://doi.org/https://doi.org/10.1016/j.jece.2018.04.026
González-Cortés JJ, Torres-Herrera S, Almenglo F et al (2021) Anoxic biogas biodesulfurization promoting elemental sulfur production in a Continuous Stirred Tank Bioreactor. J Hazard Mater 401:123785. https://doi.org/https://doi.org/10.1016/j.jhazmat.2020.123785
Huan C, Lyu Q, Tong X et al (2021) Analyses of deodorization performance of mixotrophic biotrickling filter reactor using different industrial and agricultural wastes as packing material. J Hazard Mater 420:126608. https://doi.org/https://doi.org/10.1016/j.jhazmat.2021.126608
Ikeda M, Ishima Y, Shibata A et al (2017) Quantitative determination of polysulfide in albumins, plasma proteins and biological fluid samples using a novel combined assays approach. Anal Chim Acta 969:18–25. https://doi.org/https://doi.org/10.1016/j.aca.2017.03.027
Kohlmeier M (2015) Chapter 11 - Minerals and Trace Elements. In: Kohlmeier MBT-NM (Second E (eds). Academic Press, San Diego, pp 673–807
Kredich NM, Tomkins GM (1966) The Enzymic Synthesis of l-Cysteine in Escherichia coli and Salmonella typhimurium. J Biol Chem 241:4955–4965. https://doi.org/https://doi.org/10.1016/S0021-9258(18)99657-2
Li G, Liang Z, An T et al (2015) Efficient bio-deodorization of thioanisole by a novel bacterium Brevibacillus borstelensis GIGAN1 immobilized onto different parking materials in twin biotrickling filter. Bioresour Technol 182:82–88. https://doi.org/https://doi.org/10.1016/j.biortech.2015.01.120
Liang C, Wei D, Zhang S et al (2021) Removal of antibiotic resistance genes from swine wastewater by membrane filtration treatment. Ecotoxicol Environ Saf 210:111885. https://doi.org/https://doi.org/10.1016/j.ecoenv.2020.111885
Mander L, Liu H-W (2010) Comprehensive natural products II: chemistry and biology. Elsevier
Matusiak K, Oleksy M, Borowski S et al (2016) The use of Yucca schidigera and microbial preparation for poultry manure deodorization and hygienization. J Environ Manage 170:50–59. https://doi.org/https://doi.org/10.1016/j.jenvman.2016.01.007
Meyer B, Imhoff JF, Kuever J (2007) Molecular analysis of the distribution and phylogeny of the soxB gene among sulfur-oxidizing bacteria – evolution of the Sox sulfur oxidation enzyme system. Environ Microbiol 9:2957–2977. https://doi.org/https://doi.org/10.1111/j.1462-2920.2007.01407.x
Mu T, Yang M, Xing J (2021) Performance and characteristic of a haloalkaliphilic bio-desulfurizing system using Thioalkalivibrio verustus D301 for efficient removal of H2S. Biochem Eng J 165:107812. https://doi.org/https://doi.org/10.1016/j.bej.2020.107812
Mudliar S, Giri B, Padoley K et al (2010) Bioreactors for treatment of VOCs and odours – A review. J Environ Manage 91:1039–1054. https://doi.org/https://doi.org/10.1016/j.jenvman.2010.01.006
Olson KR, Gao Y, Arif F et al (2018) Metabolism of hydrogen sulfide (H2S) and Production of Reactive Sulfur Species (RSS) by superoxide dismutase. Redox Biol 15:74–85. https://doi.org/https://doi.org/10.1016/j.redox.2017.11.009
Pokorna D, Zabranska J (2015) Sulfur-oxidizing bacteria in environmental technology. Biotechnol Adv 33:1246–1259. https://doi.org/https://doi.org/10.1016/j.biotechadv.2015.02.007
Schomburg D, Schomburg I, Chang A (eds) (2008) Cysteine desulfurase BT - Springer Handbook of Enzymes: Class 2 · Transferases XII EC 2.7.8–2.9.1. Springer Berlin Heidelberg, Berlin, pp 238–246
Tavolieri AM, Murray DT, Askenasy I et al (2019) NADPH-dependent sulfite reductase flavoprotein adopts an extended conformation unique to this diflavin reductase. J Struct Biol 205:170–179. https://doi.org/https://doi.org/10.1016/j.jsb.2019.01.001
Wysocka I, Gębicki J, Namieśnik J (2019) Technologies for deodorization of malodorous gases. Environ Sci Pollut Res 26:9409–9434. https://doi.org/10.1007/s11356-019-04195-1
Xuan G, Lü C, Xu H et al (2020) Sulfane Sulfur is an intrinsic signal activating MexR-regulated antibiotic resistance in Pseudomonas aeruginosa. Mol Microbiol 114:1038–1048. https://doi.org/https://doi.org/10.1111/mmi.14593
Yang H, Gao K, Feng S et al (2015) Isolation of sulfide remover strain Thermithiobacillus tepidarius JNU-2, and scale-up bioreaction for sulfur regeneration. Ann Microbiol 65:553–563. https://doi.org/10.1007/s13213-014-0891-2
Yun SJ, Seo Y (2013) Removal of bacteria and odor gas by an alumina support catalyst and negative air ions. J Aerosol Sci 58:33–40. https://doi.org/https://doi.org/10.1016/j.jaerosci.2012.12.006
Zhuo Y, Han Y, Qu Q et al (2019) Characteristics of low H2S concentration biogas desulfurization using a biotrickling filter: Performance and modeling analysis. Bioresour Technol 280:143–150. https://doi.org/https://doi.org/10.1016/j.biortech.2019.02.007

Download PDF

Editorial decision: Major Revision
18 Dec, 2021
Reviews received at journal
07 Nov, 2021
Reviewers invited by journal
21 Oct, 2021
First submitted to journal
26 Sep, 2021

You are reading this latest preprint version

Investigation of Biodesulfurization by A Novel Pseudomonas Strain and the Underlying Metabolic Mechanisms

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Microorganism enrichment, isolation and idenfication

2.2 Optimization of cultivation conditions

2.3 Analytical techniques

2.4 Genome sequencing

2.5 Analysis of gene expression level

3. Results And Discussion

3.1 Screening of an effective thiosulfate removing strain

3.2 Optimization: temperature and shaking speed

3.3 Genome sequencing and functional annotation

3.4 Construction of sulfur metabolic pathway

3.5 Gene expression analysis of sulfur metabolism

4. Conclusion

Declarations

References

Status:

Version 1