2.1. Animals. Female Sprague-Dawley rats obtained from Taconic Biosciences (Hudson, NY) (where they are routinely bred and maintained on 12-hour daily photoperiods for extended generations [Taconic Biosciences]) were used in these studies. Such animals at 10 weeks of age; (body weight 220 ± 3 g) were maintained on long 14-hour daily photoperiods (14hours light / 10 hours dark) typical of the summer lean, insulin sensitive season in temperate zone rodents [1] and allowed to feed regular rodent chow (2018 Teklad rodent diet, Envigo, East Millstone, NJ) ad libitum. Female rats of this strain and age are euinsulinemic, glucose tolerant and lean [25]. Rats were habituated to our climate-controlled animal facilities for at least 7 days before initiation of any experimentation.
2.2. Experimental Design. Two separate studies were conducted to assess the impact of peri-SCN area dopamine neuron lesion on peripheral glucose tolerance, insulin sensitivity, adipose and liver lipid metabolism gene profile, obesity, and vascular biology. In Study 1, rats were randomly assigned to one of two treatment groups and infused bilaterally at the peri-SCN area with either vehicle or the dopamine neurotoxin, 6-hydroxydopamine (6-OHDA) at 8 µg/side following systemic intraperitoneal administration of protriptyline (20 mg/kg, i.p.) to protect norepinephrine and serotonin neurons. Then, an intraperitoneal glucose tolerance test (GTT) was performed at 16 weeks following the lesion to examine any effect on peripheral glucose metabolism and insulin sensitivity during the GTT. Body weight change from baseline was also obtained. In Study 2, based upon the results of Study 1, animals were similarly treated as in Study 1 with the exceptions that the 6-OHDA dose was lowered to 2–4 µg/side (there was no significant metabolic response difference between 2 and 4 µg/side 6-OHDA doses, and data were combined for analysis vs vehicle control), GTT data were obtained at both 8 and 16 weeks following lesion, and measures of humoral factors regulating metabolism, adipose and liver metabolic gene expressions, body fat store levels, and vascular biology (blood pressure and heart rate) were also taken at week 16. One group received an infusion of dopaminergic neurotoxin into the peri-SCN area bilaterally; the other received a vehicle infusion. Intraperitoneal GTTs were performed 8 and 16 weeks after the neurotoxin infusion. Blood pressure and heart rate were measured after two days recovery from the GTT at 16 weeks. Body weight and food consumption were monitored during the course of the study. Animals were sacrificed after the vascular biology assessments and blood samples were collected for analyses of humoral metabolic factors, including plasma insulin, glucose, norepinephrine (NE) and leptin. Parametrial and retroperitoneal fat pads were removed and weighed as an index of body fat store level. Adipose and liver tissues were stored at -80 0C for analyses of lipid metabolism gene expressions.
A separate histological study was conducted to verify the viability of the SCN neurons several days following such peri-SCN 6-OHDA treatment. Also, a separate study was conducted to verify the specific peri-SCN dopaminergic neuronal lesion several days following such peri-SCN administration of 6-OHDA. All animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Experimental Animals (2011) and also with the protocols approved by the Institutional Animal Care and Use Committee of VeroScience, LLC.
2.3 Peri-SCN 6-OHDA infusion impact on SCN neurons. Four weeks after peri-SCN neuron lesioned (4 or 8 µg/side 6-OHDA plus protriptyline 20 mg/kg ip) rats were sacrificed by decapitation. Their brains were quickly collected, and postfixed in buffered formalin and then transferred to buffered sucrose solution, frozen, and sliced into 50-mm coronal sections through SCN in a cryostat. Sections were mounted on a gelatin-coated slide and stained with cresyl violet to assist in evaluation of the lesions post infusion of 6-OHDA.
2.4. Peri-SCN 6-OHDA infusion impact on peri-SCN dopaminergic neurons
Following 6-OHDA neurotoxin treatment to the peri-SCN area as described below at a dose of either 2 or 8 ug/SCN side in separate groups of animals, a 30-gauge stainless steel microdialysis guide cannula was stereotaxically implanted at the right side of SCN with coordinates: 1.3 mm posterior to bregma, 0.4 mm right side of lateral to the midsagittal suture, and 8.4 mm ventral to the dura. The cannula was anchored firmly to the skull with stainless steel screws and secured to the surface with dental cement. Microdialysis experimentation was conducted after 12 to 20 days of lesioning. During the test days, each animal was placed in an acrylic bowl with free access to food and water. A 32-gauge dialysis probe with a 1-mm-long tip of semi-permeable membrane (20,000 molecular weight cutoff) was inserted into the guide cannula and the probe membrane protruded 1 mm outside the guide cannula. Using a microinjection pump (CMA/100), Cerebral Spinal Fluid (CSF) solution was continuously perfused through the probe at a rate of 0.5 µl/min. The probe was connected to the microinjection pump by micrbore Teflon tubing through a counterbalanced 2-channel liquid swivel arm (Bioanalytical Systems, West Lafayette, IN, USA) attached to the rim of the bowl, thus permitting the animal to move freely without the tubing becoming tangled during the experimental period. Dialysate collection began 2 h after insertion of the probe to allow some recovery from potential tissue damage by probe insertion. Samples were collected into 300 µl glass vials (containing 2 µl of 0.1 N perchloric acid solution) at 30 minute intervals through an automated refrigerated fraction collector (modified CMA/170, CMA microdialysis, MA) over a 3 hour period while animals were maintained on a 14-hour daily photoperiod and allowed free access to food and water. The 10 µl dialysis samples were analyzed immediately by HPLC with electrochemical detection (Coulochem III electrochemical detector, ESA, Chelmsford, MA), as described previously [26]. Dopamine (DA) and DA metabolites (3,4-dihydroxyphenylacetic acid [DOPAC], homovanillic acid [HVA]), NE and NE metabolite (3-methoxy-4-hydroxyphenylglycol [MHPG]), and the serotonin metabolite (5-hydroxyindoleacetic Acid [5-HIAA]) in microdialysis samples were measured. All probes were tested for recovery in vitro prior to use and data were adjusted for recovery rate.
2.5. Peri-SCN Dopamine Neuron-Selective Lesion with 6-OHDA. 6-OHDA neurotoxin treatment to the peri-SCN area was performed in a manner to damage only dopaminergic neuronal input to the SCN without damaging neurons within the SCN itself (see Results, Fig. 1). Each animal was anesthetized with ketamine/xylazine (60/5 mg kg− 1 body weight, i.p.) and placed in a stereotaxic frame (David Kopf). A double stainless steel guide cannula was implanted at coordinates 1.3 mm anterior to bregma, 0.4 mm each side of lateral to the midsagittal suture, and 7.4 mm ventral to the surface of the skull (landing at 2 mm above SCN). The injection cannula (33-gauge) inserted through the guide cannula extended to a total depth of 9.4 mm. 6-OHDA was infused bilaterally to the peri-SCN area of each animal to selectively damage or destroy dopaminergic neuron terminals outside of the SCN, twenty minutes after each animal received an intraperitoneal injection of protriptyline (20 mg/kg, i.p.) to block neurotoxic effects of 6-OHDA to noradrenergic and serotonergic neurons [26]. This is a well established method to selectively damage dopaminergic neurons without affecting noradrenergic or serotonergic neurons [26]. Although there are dopamine D2 and D1 receptors and amino acid decarboxylase within the SCN itself, there are no tyrosine hydroxylase positive neuronal cell bodies within the nucleus [24], thus precluding damage to SCN neruons with this procedure. In Study 1, rats were subjected to infusion of either 6-OHDA (8 µg/side, N = 14) in saline containing 0.2% ascorbic acid or vehicle (saline containing 0.2% ascorbic acid, N = 8) at the peri-SCN area bilaterally. The intra-cannula infusion was carried out over 2 min at a flow rate of 0.2 µl/min (a total injection volume of 0.4 µl for each side of SCN). A further 60 s was allowed after the infusion for the solution from the tip of the cannula to diffuse into the peri-SCN area. In Study 2, rats were similarly handled, prepared and treated with 6-OHDA infusion at the peri-SCN area at 2–4 µg/side or vehicle (N = 9–16/group, see results).
2.6. Glucose Tolerance Test. Glucose tolerance tests were performed 5 hours after light onset at 16 weeks following the SCN 6-OHDA lesion in Study 1 or at 8 and 16 weeks following the peri-SCN area 6-OHDA lesion in Study 2. A 50% glucose solution was administered intraperitoneally (3 g/kg body weight) and blood samples were taken from the tail before glucose administration and 30, 60, 90, 120 minutes after glucose injection. Blood samples were collected into vials with 5 µl EDTA and were immediately separated by centrifugation and stored at -80 C until assay of insulin. Matsuda index [27]was calculated to assess insulin sensitivity. The Matsuda index was calculated as follows: Matsuda index = 10,000/sqrt {0 minute (before loading) plasma glucose (mg/dL) × 0 minute serum insulin (µU/mL) × 120 minutes plasma glucose × 120 minutes serum insulin}.
2.7. Assay of metabolic parameters. Blood glucose concentrations were determined at the time of blood collection by a blood glucose monitor (OneTouch Ultra, LifeScan, Inc; Milpitas, CA, USA). Plasma insulin, leptin and NE were assayed by an enzyme immunoassay using commercially available assay kits utilizing anti-rat serum and rat insulin, leptin and NE as standards (ALPCO Diagnostics, Salem, NH, USA).
2.8. Assay of adipose lipid metabolism genes expression. Total RNA was isolated from frozen parametrial adipose tissue samples utilizing Trizol Reagent (ThermoFisher). Total RNA quantity and purity was determined by UV spectroscopy and the concentration was normalized prior to reverse transcription reaction. Reverse transcription was performed with iScript RT Supermix for RT-qPCR (BioRad), followed by qPCR. The mRNA quantities of studied genes were assessed with use of the following probes: hormone sensitive lipase (HSL) was determined with ThermoFisher Assay Rn00689222, phosphoenolpyruvate carboxykinase (PEPCK1) was determined with ThermoFisher Assay Rn01529014, phosphoenolpyruvate carboxykinase 2, (mitochondrial PEPCK2) was determined with ThermoFisher Assay Rn03648110, fatty acid synthase (FAS) was determined with ThermoFisher Assay Rn01463550, acetyl-CoA carboxylase 1 (ACC1) was determined with ThermoFisher Assay Rn01456588 and SsoAdvanced Universal Probes Supermix (BioRad). Pyruvate dehydrogenase complex x (PDHX), glucose 6-phosphate dehydrogenase (G6PDH), malic enzyme (ME1), and mitochondrial ATP synthase complex F1 (ATPF1) were quantified with PerfeCTa® SYBR® Green FastMix® Low ROX QPCR Master Mix (Quantabio) on AriaMX qPCR instrument with the following primer pairs (Sigma Aldrich):
ATPF1 Forward 5’ CTGGCGACAGGCTGGAC
ATPF1 Reverse 5’ TGCTTCACCTGGAAGACTCC
G6PD Forward 5’CCTGATGCCTATGAACGCCT
G6PD Reverse 5’CCCTCATACTGGAAGCCCAC
PDHX Forward 5’TACTGTGCCTCACGCCTATG
PDHX Reverse 5’GATGCTTTGGGCCTTCTCCA
ME1 Forward 5’ ATGGAGAAGGAAGGTTTATCAAAG
ME1 Reverse 5’ GGCTTCTAGGTTCTTCATTTCTTC
2.9. Assay of liver lipid metabolism genes expression. Total RNA was isolated from frozen liver tissue samples with Trizol Reagent (ThermoFisher). Total RNA quantity and purity was determined by UV spectroscopy and concentration was normalized prior to reverse transcription reaction. Reverse transcription was performed with iScript RT Supermix for RT-qPCR (BioRad), followed by qPCR. The mRNA quantity of G6PDH, mitochondrial ATPF1, FAS, Carnitine O-Palmitoyltransferase 1 (CPT1), ACC1, Tumor necrosis factor α (TNFα), Monocyte Chemoattractant Protein 1 (MCP1) were quantified with PerfeCTa® SYBR® Green FastMix® Low ROX QPCR Master Mix (Quantabio) on AriaMX qPCR instrument with the following primer pairs (Sigma Aldrich):
G6PDH Forward 5’CCTGATGCCTATGAACGCCT
G6PDH Reverse 5’CCCTCATACTGGAAGCCCAC
ATPF1 Forward 5’ CTGGCGACAGGCTGGAC
ATPF1 Reverse 5’ TGCTTCACCTGGAAGACTCC
FASN Forward 5’ AATATATTGAAGCCCATGGCA
FASN Reverse 5’ GCCCAAACCCCATTTTCT
CPT1 Forward 5’ TCGTGGTGGTGGGTGTGAT
CPT1 Reverse 5’ AGCAGCACCTTCAGCGAGT
ACC1 Forward 5’ GATTCATAATTGGGTCCGTGTCT
ACC1 Reverse 5’ CTAGGTGCAAGCCGGACAT
TNFα Forward 5’ GTAGCCCACGTCGTAGCAAA
TNFα Reverse 5’ AAATGGCAAATCGGCTGACG
MCP1 Forward 5’ TAGCATCCACGTGCTGTCTC
MCP1 Reverse 5’ GAGCTTGGTGACAAATACTACAGC
2.10. Blood Pressure and Resting Heart Rate Measurements. Systolic and diastolic blood pressure (BP) and resting heart rate (RHR) were non-invasively measured by determining the tail blood volume with a volume pressure recording sensor and an occlusion tail-cuff (CODA-6 non-invasive blood pressure system, Kent Scientific Corp. Torrington, CT) in conscious rats during the animals’ normal sleeping period of the day (5 hours after light onset) following the manufacturer’s instructions. Several days before experimental recordings, rats were acclimated to the restraining cage and the tail cuff to minimize or reduce any stress influence on the readings. BP and heart rate values per animal were the result of an average of 6–8 measurements.
2.11. Statistical Analysis. All date are expressed as mean ± SEM. Data comparing the group mean values of the plasma glucose and insulin during GTTs, and neurotransmitter levels in the microdialysis experitment were analyzed by two-way repeated measures ANOVA or one-way ANOVA as appropriate, followed by Duncan’s New Multiple range tests. Differences in the group mean values of the weight change from baseline, areas under the glucose or insulin curves during GTTs, fasting plasma insulin, glucose, NE or leptin levels, blood pressures, and hear rate were each determined by unpaired t-tests. A statistical value of P < 0.05 (2-tailed) was considered statistically significant.