Rabbit tissues were kindly provided by Paul Flechsig Institute of Brain Research, University of Leipzig. Rabbit skin and whisker pad tissue was collected from 12-month-old wild-type chinchilla bastard rabbits that were sacrificed within another experimental set up (n=3).
Isolating rabbit epidermal melanocytes (rEM)
Rabbit skin tissue was harvested from dorsal skin after complete epilation and collected in PBS ++ (D-PBS w/o Ca & Mg containing 100 μg/ml Gentamycin and 20 μg/ml Amphotericin B) medium. After removal of subcutaneous fat and muscle and intensive washing with ice-cold PBS++, the skin tissue was chopped into long narrow pieces (1mm x 10 mm), and incubated in Dispase for 40 min at 37°C. Dispase was neutralized with Fetal Bovine Serum (FBS, ThermoFisher Inc., Waltham, MA, USA) and the digested tissue was rinsed with D-PBS. Epidermis was separated from the digested skin tissue, and sliced into small pieces (1mm x 1 mm). Epidermal slices were incubated in Trypsin for 40 min at 37°C. After neutralizing trypsin using FBS, epidermal cell suspension was vortexed vigorously for 5 min, filtered through 70 μm strainer, plated in T75 flask and cultured in DermaLife Melanocyte Medium, (DLM, Lifeline® Cell Technology, US) in hypoxic conditions (5% O2, 5% CO2) at 37°C. The culture medium was changed each 48 h. When the cell density reached 70% confluency, the cells were subcultured by differential trypsinization for 11 passages.
Isolating rabbit hair follicle melanocytes (rMORS)
The facial skin area of a rabbit containing bilateral whisker pads was harvested and collected in PBS ++ medium. After removal of muscle and connective tissue, the whisker pad skin was intensively washed with ice-cold PBS ++ and incubated in 2mg/mL Collagenase V at 37 °C for 3 hours. After neutralizing and rinsing, the visible whisker hair shafts were plucked from the loosened dermal tissue along with their follicle-sinus complex. After rinsing, the follicle-sinus complex was micro-dissected to remove the dermal cavernous envelope, hereby obtaining an intact rabbit hair follicle outer root sheath (ORS). Whisker hair follicles were intensively washed and treated with 5mg/ml Collagenase V at 37 °C for 10 min. After neutralizing and rinsing, the hair follicle was placed onto a 6-well-size Transwell membrane (Corning Inc., New York, NY, USA). Lower chamber was filled with DLM Medium and incubated in hypoxic conditions (5% O2, 5% CO2) at 37°C for 2 days. After 7-11 days of the air-liquid interface culture, the cells migrated out of the ORS and formed a cell monolayer on the nylon mesh of the Transwell insert. After 17-24 days at 50-80% confluence, the cells were detached by 0.04 %/0.03 % Trypsin/EDTA and subcultured in a T75 flask in DLM Medium. The culture medium was changed after 48 h and kept for another 3 days. When the cell density reached 70% confluency, the cells were subcultured for the next 11 passages.
Differential Trypsinization
For differential trypsinization, both rabbit rMORS and rEM were subcultured using 0.04% trypsin/0.03% EDTA at room temperature for 2-3 min. The trypsinization process was observed by a microscope to confirm that the majority of melanocytes detached and that keratinocytes were still adherent. The cells in the detached fraction were collected. Trypsin was neutralized using FBS and the cells were further sub-cultured in DLM Medium. Differential trypsinization hereby helped detach weakly adherent melanocytes from other more adherent cell types, as it has been postulated in human ORS melanocyte culture [23, 25].
Von Kossa staining
The rabbit rMORS and rEM after passage 7 were split from cell culture flasks and seeded onto Superfrost Microscope slides (ThermoFisher Inc., Waltham, MA, USA) coated with Type I collagen and left to adhere for 24 hours in the DLM medium. The cells were fixed in 4% paraformaldehyde at room temperature. After rinsing with distilled water, the cells were incubated in 2% silver nitrate solution (Carl Roth GmbH, Karlsruhe, Germany) exposed to a 254 nm UV irradiation in Cell Culture Cabinet (BW-130 Silver, Kojair Tech Oy, Vilppula, Finland) for 1 h at room temperature. After rinsing in distilled water, the unbound silver was removed by incubating slides in 5% sodium thiosulfate (Carl Roth GmbH, Karlsruhe, Germany) for 5 minutes. The cells were counterstained in Nuclear Fast Red reagent (Carl Roth GmbH, Karlsruhe, Germany) for 5 minutes, and sealed by a cover slip using anhydrous mounting media ROTI®Mount (Carl Roth GmbH, Karlsruhe, Germany). Stained melanocytes were imaged Keyence BZ-9000 microscope (Keyence GmbH, Neu-Isenburg, DE, USA).
Melanin Production in Melanocytes
To assess the melanin synthesis in the functional rMORS and rEM, melanin content was measured as previously described [23, 25]. Briefly, rMORS and rEM at P7, P9 and P11 were detached with trypsin/EDTA, washed in PBS and lysed by 3 freeze/thaw cycles. The lysate was incubated in 1 N NaOH 60 °C for 3 h with gentle agitation, and the absorbance of supernatant was measured by a spectrophotometer (Synerge, BioTek Instruments Inc., USA) at 475 nm wavelength against a reference wavelength of 620 nm. Absorbance of each sample was compared against absorbance of a synthetic melanin curve based on a 0-100 μg/ml concentration span (Sigma-Aldrich GmbH, Schnelldorf, Germany) and melanin concentration of the measured sample was retrieved by the means of linear regression. The assay provided a readout as amount of melanin and it was broken down respective to the number of cells to amount of melanin per cell.
Tyrosinase Activity
To determine tyrosinase activity of rMORS and rEM, 100µl cell lysates after freeze/thaw cycles were incubated in 200µl 5mM L-DOPA solution (in 0.1M KH2PO4 buffer, pH 7.2) for 4-5h at 37 °C in the dark incubator. The absorbance of supernatant was measured by a spectrophotometer (Synerge, BioTek Instruments Inc., USA) at 475 nm wavelength against 0.1M KH2PO4 buffer as a blank control.
L-DOPA Stimulation
To visualize the melanin production in rMORS and rEM, stimulation using L-DOPA (l-3,4-dihydroxyphenylalanine) was performed as described in [30, 31]. Briefly, rMORS and rEM were detached from cell flask plastic by trypsin/EDTA and seeded in Chamber Slides (ThermoFisher Inc., Waltham, MA, USA). After a 72 h attachment, the cells were fixed in ice-cold acetone/methanol (1:1), and incubated in 5 mM L-DOPA (Sigma-Aldrich GmbH, Schnelldorf, Germany) for 5 hours. After washing, the cells were stained with 0.05% Nile Blue solution for 20 min, and imaged by the means of Keyence microscope.
Gene Expression Analysis
rMORS and rEM at passages P3, P5, P7 and P9 were detached with trypsin/EDTA, HBSS and lysed in Qiazol Lysis Reagent (Qiagen, Hilden, Germany). Total RNA was isolated using RNeasy Plus Universal Kit (Qiagen, Hilden, Germany), and 1 μg of total RNA was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendation.
Primers for rabbit melanocyte marker genes, NES (nestin), PAX3 (paired box gene 3), MITF (microphtalmia-induced transcription factor), TYR (tyrosinase), C-KIT (receptor tyrosine kinase) and PMEL (premelanosome protein) were designed using Primer3 web version 4.1.0 (60°C annealing temperature) and manufactured by Invitrogen. The primer sequences for rabbit genes are specified in Table 1.
Table 1. Primer sequences for rabbit melanocyte marker genes [25]
Gene
|
Primer sequence
|
NES for
|
CGGGGAGTCTGATGGGTTT
|
NES rev
|
TCCTCCTCTTCCTCTTCCCC
|
PAX3 for
|
AGCCCACGTCTATTCCACAA
|
PAX3 rev
|
GTACAGTGCTCGGAGGAAGT
|
MITF for
|
CAAAGGCAGCAGGTAAAGCA
|
MITF rev
|
CTCAGGACTTGGTTGGCATG
|
TYR for
|
GTTTCTGGACTTCTGCTGGC
|
TYR rev
|
GCAGCATTCCTTTTCCACCA
|
CKIT for
|
CTGACCAGACTGAAGGGGAG
|
CKIT rev
|
GGAAGCGTTGACATCAGCAT
|
PMEL for
|
GACTTTTGCCATCCAGCTCC
|
PMEL rev
|
CAGGTGTAGGAGAGGTCAGC
|
HPRT1 for
|
GCTTCCTCCTCCTCTGCC
|
HPRT1 rev
|
CACTAATCACAACGCTGGGG
|
Target gene expression was assessed in triplicates via qRT-PCR using QuantiFast SYBR® Green PCR Kit (Qiagen, Hilden, Germany). 50 ng cDNA was used for each 20 μl reaction. Thermal cycling was carried out at 95°C for 60s, followed by 40 cycles of 95°C for 10 s, and 60°C for 30 s. Expression level of analyzed genes was normalized to the mean expression of hypoxanthine-guanine phosphor-ibosyltransferase (HPRT-1) and calculated by a comparative 2^−△△Ct method [34] of relative quantification using software 7500 Software v2.3 (Qiagen, Hilden, Germany).
Statistical Analysis
Statistical evaluation of the quantitative results was done by an unpaired t-test or nonparametric Mann–Whitney test. p values ≤ 0.05 were regarded as statistically significant.