Reagents
Design of the Plasmids for Base Editing and Functional Analysis
- Plasmids: epi-ABEmax (Addgene plasmid #135974), epi-BE4max (Addgene plasmid #135975).
- PCR primers or oligos for sgRNA construction can be ordered with standard desalting purification at GUANGZHOU IGE BIOTECHNOLOGY LTD or other suppliers.
- PrimeSTAR® Max DNA Polymerase (TAKARA, cat. no. R045Q).
- FastPure® Gel DNA Extraction Mini Kit (Vazyme, cat. no. DC301)
- EndoFree Mini Plasmid Kit II (TIANGEN, cat.no. 4992422)
- Agarose (Sigma, cat. no. A9539)
- 100 bp DNA Ladder (Vazyme, cat.no. MD104-01)
- Ultra GelRed Nucleic Acid Stain (Vazyme, cat. no.GR501-01)
- BspQI (New England BioLabs, cat. no. R0712S)
- T4 DNA Ligase (Vazyme, cat. no. C301-01)
- FastPure Plasmid Mini Kit (Vazyme, cat. no. DC201-01)
- DH5α chemically competent E. coli (Vazyme, cat. no. C502-02)
- Ampicillin, 100 mg/ml (Beyotime, cat. no. ST008)
- TIANamp Genomic DNA Kit (TIANGEN, cat.no. 4992254)
Cell Culture and Cardiomyocytes Differentiation
- HEK293T cell line (Life Technologies, cat. no. R70007)
- Human Embryonic Stem Cell H9 (National Collection of Authenticated Cell Cultures, China, cat. no. SCSP-302)
- DMEM, high glucose (Life Technologies, cat. no. 10566016)
- Dulbecco’s PBS w/o Ca2+, Mg2+ (D-PBS) (Hyclone, cat. no. SH30028.02)
- Fetal Bovine Serum (FBS) (Life Technologies, cat. no.10270-106)
- Opti-MEM™ reduced-serum medium (Life Technologies, cat. no. 11058-021)
- Penicillin/streptomycin (Pen/strep), 100× (Life Technologies, cat. no. 15140-122)
- EDTA (Cellapy, cat. no.CA3001500)
- Lipofectamine 3000 transfection reagent (Life Technologies, cat. no. L3000008)
- Accutase® (Sigma, cat. no. A6964-500ML)
- ROCK1 inhibitor (Y-27632) (Selleck, cat. no. S6390)
- P3 primary cell 4D-Nucleofector X kit S (Lonza, cat. no. V4XP-3032)
- L-ascorbic acid 2-phosphate (Sigma, cat. no.49752)
- Recombinant Human Serum Albumin (Science Cell, cat. no. OsrHSA)
- B-27™ Supplement, minus insulin (Life Technologies, cat. no. A1895601)
- B-27™ Supplement, serum free (Life Technologies, cat. no. 17504044)
- RPMI 1640 Medium (Life Technologies, cat. no. 61870150)
- RPMI 1640 Medium, no glucose (Life Technologies, cat. no. 11879020)
- CHIR-99021(Selleck, cat. no. S1263)
- Wnt-C59 (Selleck, cat. no. S7037)
- mTeSR-1 medium (STEMCELL Technologies, cat. no. 85850)
- Matrigel® hESC-Qualified Matrix (Corning, cat. no. 354277)
- Sodium DL-lactate (Sigma, cat. no. 71720)
- Blasticidin S HCl (Selleck. cat. no. S7419)
Equipment
- Standard microcentrifuge tubes, 1.5 ml (Eppendorf, cat.no. 0030125150)
- 15 ml Centrifuge Tube (Corning, cat. no. 430791)
- Tissue culture dish, 100×20 mm (Corning, cat. no. 353003)
- Tissue culture plate, 6 wells (Corning, cat. no. 353934)
- Tissue culture plate, 96 wells (Corning, cat. no. 353075)
- Cellometer AUTO T4 Bright Field Cell Counter (Nexcelom, cat. no. AUTO T4)
- NanoDrop 2000 device, UV spectrophotometer (ThermoScientific)
- 4D-Nucleofector™ System (Lonza, cat. no. AAF-1002Band AAF-1002X)
- 1ml sterile syringe (WEIGAO Group Medical Polymer CO., LTD, cat. no. ZSQWG1)
Softwares and Online Tools
Culture Medium
- HEK293T cell culture medium (500 ml): 440 ml DMEM, 50 ml FBS, 5 ml Pen/Strep. Store at 4 °C.
- CDM3 (500 ml): 500 ml RPMI 1640, 0.25 g of Recombinant Human Serum Albumin, and 106.5 mg of L-ascorbic acid 2-phosphate. Store at 4 °C.
- Collagenase solution (2 mg/mL): Dissolve 500 mg of collagenase type I in 200 mL of D-PBS. Add 50 mL of fetal bovine serum
Methods
Selecting editable LQT disease mutation loci
- The widely used base editing tools ABE or CBE can replace A with G and C with T. Based on this, our choice of mutation sites for LQT disease should be C>T, or A>G (for antisense chains, it is G>A, T>C). More than 90% of LQT is caused by mutations in the KCNQ1, KCNH2, and SCN5A genes. Therefore, we mainly screened for these three genes. The Human Gene Mutation Database (HGMD®) is a robust database that collates all known (published) gene lesions responsible for human inherited disease. We use this database to screen LQT mutations.
- Input KCNQ1 OR KCNH2 OR SCN5A
- Select: Gene Symbol
- Select: Go!
- Select: Missense/nonsense
- Click: Get mutations
- Check: “codon change” and “Phenotype”
- All A>G, G>A, C>T, T>C mutation loci were recorded
- Open the NCBI gene database https://www.ncbi.nlm.nih.gov/gene/?term=
- Enter the gene name（for example: KCNQ1)
- Click “Search”
- Chose “Homo sapiens”
- Click “GenBank”
- Click “Send to”
- Download the gene sequence file
(See Note 1)
sgRNA Oligos Design
After the sgRNA is designed, we can first evaluate its editing efficiency on the BE-Hive website. To evaluate sgRNAs, on the website:
- Step1: Input Sequence: paste your target sequence into the input sequence box
- Step2: select: base editor/cell type
- Step3: chose CRISPR protospacer
Annealing and Cloning of sgRNA Oligos
1. Pick a 20 bp spacer ahead of the PAM sequence (5’-NGG-3’) in the target locus, and then synthesize the two oligonucleotides as follows:
Top: 5’-tttNNNNNNNNNNNNNNNNNNNN-3’
Bottom: 5’-aacN’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’N’-3’
For example, the selected spacer and PAM sequence for the KCNQ1L114P/+ gene is 5’-GCTCGAGGAAGTTGTAGACG-CGG -3’. The sequences of KCNQ1L114P/+ sgRNA oligonucleotides are as follows:
KCNQ1L114P/+ Top: 5’-tttGCTCGAGGAAGTTGTAGACG -3’
KCNQ1L114P/+Bottom: 5’-aacCGTCTACAACTTCCTCGAGC -3’
(See Note 2)
2. Annealing the oligonucleotides as indicated below.
|
100uM KCNQ1L114P/+ Top
|
1ul
|
|
100uM KCNQ1L114P/+ Bottom
|
1ul
|
|
10X T4 DNA ligation buffer
|
1ul
|
|
ddH2O
|
7ul
|
Place the above samples in a 95°C water bath, switch off the power, and cool naturally to room temperature. Alternatives: You can anneal the oligonucleotides using a thermocycler instead of a hot water bath. Incubate the reaction solution at 95 °C for 5 min and then slowly cool it down to room temperature (20-30°C) using a thermocycler—the temperature decreases by 1°C per 10s.
3. Dilute the annealed oligonucleotides 20 folds with ddH2O. Clone the annealed oligonucleotide into the sgRNA expression plasmid as indicated below.
|
Diluted annealed oligonucleotides
|
3ul
|
|
ABE/CBE sgRNA expression plasmid
|
1ul
|
|
T4 DNA Ligase
|
1ul
|
|
10X T4 DNA ligase buffer
|
2ul
|
|
ddH2O
|
13ul
|
Place at 37 °C and ligate for 5 minutes (See Note 3)
4. According to the manufacturer's protocol, transform 10 uL ligated product into 50 uL E. coli DH5a competent cells. The cells are plated onto an LB agar plate supplemented with the Ampicillin, and the plate is incubated at 37°C for 14-16 hours (See Note 4)
5. Randomly pick several colonies to verify the successful cloning by Sanger sequencing. Sequencing primer: ATTCTTTCCCCTGCACTGTACCCC (See Note 5)
6. Extract the plasmids by EndoFree Mini Plasmid Kit II according to the manufacturer’s protocol. Determine the concentration of the extracted plasmid using NanoDrop.
Base Editing and Blasticidin Selection
7. Cells were plated into 48-well plates and transfected the next day at approximately 70% confluency.
8. 500 ng of epi-ABEmax/epi-AncBE4max plasmid was transfected using Lipofectamine 3000 according to the manufacturer’s instructions on day 1. (See note 6)
9. Cells were passaged on day 2 and selected by blasticidin. 2 µg/ml of blasticidin was added into the growth media, except on days 2, 6, and 11, where 8, 4, and 0 µg/ml of blasticidin were used, respectively. Transfected cells were harvested for analysis on days 6, 11, and 16. The antibiotic screening time can be shortened when editing efficiency is enough.
10. According to the manufacturer's instructions, the genomic DNA was isolated using TIANamp Genomic DNA Kit. Targets of base editing were amplified by PCR using PrimeSTAR® Max DNA Polymerase. The PCR products were sequenced using Sanger sequencing, and the editing efficiency was analyzed by EditR (Kluesner et al., 2018) or BEAT (https://hanlab.cc/beat/).
Single Cell-Derived Clone Screen
11. The antibiotic-iPSCs were passaged with EDTA. Then, 1 × 105 cells were seeded on a Matrigel pre-coated 10 cm dish using mTeSR-1 cell culture medium with 5 µM of Y-27632. (See note 7)
12. Twenty-four hours later, the mTeSR-1 media was replaced by new media without Y-27632. This media was changed every two days.
13. Ten days after seeding, the single cell-derived clones were picked up using a 1 ml sterile syringe and divided into two halves. One half was placed on a Matrigel pre-coated 96-well plate for cell expansion. The other half extracted DNA using the TIANamp Genomic DNA Kit for DNA sequencing. (See note 8)
Genotyping PCR
14. Design Forward and Reverse primers flanking the region targeted by the sgRNAs for the genotyping. The PCR will be performed to confirm the outcomes of base substitution. This experiment is to extract DNA from a small number of cells for PCR experiments, and the steps are as follows:
- Aspirate cells with a 50ul pipette, transfer to a 200ul PCR tube, and quick spin
- 95°C for 10 minutes and cold down to 4°C
- Add 2ul of 20mg/ml proteinase K solution and mix by quick spin
- 55°C for 1hour, 95°C for 10 minutes and cold down to 4°C
The solution obtained is the cellular DNA extraction solution, which can be used as a template for PCR
|
2x PrimeSTAR® Max DNA Polymerase
|
25 ul
|
|
Primer-F
|
2 ul
|
|
Primer-R
|
2 ul
|
|
DNA solution
|
8 ul
|
|
ddH2O
|
13 ul
|
- Gently mix all the reagents and collect them by a quick spin. The order of addition of the reagents can be random.
- Polymerase chain reaction (PCR)
(See note 9)
Off-Target Analysis
15. For each target site, five potential off-targets were selected based on Cas-Offinder and PCR-amplified for Sanger sequencing.
Cardiomyocyte Differentiation
16. Cells (∼90% confluency) were seeded on a Matrigel pre-coated 6-well plate at a ratio of 1:6 in mTeSR-1 media. (See note 10)
17. The media was changed to CDM3 supplemented with 6 µM of CHIR99021 when the cells reached ∼75% confluency.
18. After 48 h, the media was changed to CDM3 supplemented with 2 µM of Wnt-C59. After 2 days, the media was changed to CDM3 and refreshed every 2 days. After differentiation for 7– 8 days, spontaneous contracting cells could be observed.
19. On day 12, Cardiomyocytes (CMs) were purified using a metabolic-selection method. The medium consisted of RPMI 1640 without glucose, 213 µg/ml of L-ascorbic acid 2-phosphate, 500 µg/ml of Oryza sativa-derived recombinant human albumin, and 5 mM of sodium DL-lactate.
20. After purification, CMs were cultured with RPMI 1640 and B27 (with insulin). For cellular maintenance, the medium was changed every 3 days.
LQT Phenotype Identification Using MEA
21. CMs were digested with Accutase. (See note 11)
22. CytoView MEA24 plates (Axion Biosystems, Inc., Atlanta, United States) were pre-coated overnight using a 0.5% Matrigel phosphate-buffered saline (PBS) solution.
23. 15,000 CMs were plated on each multi-electrode array (MEA) well with RPMI/B27 medium and cultured for three days.
24. When the cellular electrophysiological activity became stable, the experimental data were recorded using Maestro EDGE (Axion Biosystems, Inc., Atlanta, United States) according to the MEA manual. The data were analyzed using the AxIS Navigator, Cardiac Analysis Tool, and IGOR software.
Notes
- The potential therapeutic targets were further screened according to the ABE/CBE sgRNA design rules, which must be in the form of 20nt+PAM. The mutation site is in the sgRNA edit window 2-8. Therapeutic targets eligible for gene editing were obtained. To avoid bystander editing during gene editing, we recommend only one of the mutation loci in the edit window 2-8 of sgRNA. Other databases like ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/)are also recommended.
- ttt and aac are the sequences that matche the sticky end produced by the enzymatic cleavage of the plasmid used in this paper. You should add the appropriate sequence to the sticky end sequence produced by the plasmid you are using.
- The sgRNA expression plasmids in this protocol contain epi-ABEmax, epi-AncBE4max, which is an all-in-one episomal vector expressing a single guide RNA (sgRNA) with an adenine base editor (ABE) or a cytosine base editor (CBE). If you are using two plasmids for sgRNA and base editor expressing, you only need to ligate oligonucleotides to the sgRNA expression vector.
- You should choose the appropriate antibiotic according to the resistance expressed by your plasmid.
- You should choose the appropriate sequencing primer according to your plasmid.
- We recommend the use of the LONZA 4D Nuclear Transfection System to transfer plasmids into cells, programmed as CA137.
- EDTA is less toxic to cells. To obtain single cells, we try to increase the contact time between EDTA and the cells until the cells are observed as single cells under the microscope. Typically contact time is10-20 minutes.
- The cell clone must not be too small, or the clone will fail to pick up. Generally, under a 10x microscope, the cell clone should fulfill the entire field. The microscope should be transferred to a biosafety cabinet in advance and UV irradiated for at least half an hour.
- PCR conditions should be referred to the instructions for the polymerase used. We should determine primer Tm values in advance. The amount of DNA extracted by our method is minimal, and therefore the number of cycles of PCR should be increased, with a recommended setting of 38 cycles.
- Matrigel was diluted using pre-cooled PBS solution at a ratio of 1:500. The process of CM differentiation is susceptible to mycoplasma, and we strongly recommend testing the mycoplasma before CM differentiation. The cell culture medium supernatant is aspirated and used as a template for PCR amplification using mycoplasma-specific primers and agarose gels for validation. mycoplasma-specific primer-F: CACCATCTGTCACTCTGTTAAC, R: GGAGCAAACAGGATTAGATAC
- If the CM differentiation is inefficient, dead cells are produced, and many cell fragments are released during CM purification. These cell fragments can bind to collagen, the cardiomyocyte, in a pile and hinder the CM digestion. Collagenase can be an excellent solution to this problem. Add collagenase solution to CM and incubate at 37 °C for 1 h. Aspirate the collagenase solution, add Accutase, and placed at 37 °C for 30 minutes.