Ethics declarations
All experimental protocols present here were strictly conducted following the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, China), and entirely approved by the Animal Care and Use Committee, Sichuan Agricultural University.
Animals and samples collection
A total of 12 female goat fetuses and kids aged 45, 60, and 105 days of gestation, and 3 days postnatal (n = 3 per stage) were randomly chosen and humanely sacrificed at the Jianzhou Big-Eared goats farm (Sichuan province, China). Tissue samples from six organs, including heart, liver, lung, spleen, kidney, and longissimus dorsi (LD) muscle were quickly collected and snap-frozen in liquid nitrogen for further study.
Isolating goat MuSCs
We successfully isolated MuSCs from LD muscles of neonatal goats using the typical protocols described previously [62]. Briefly, sampled LD muscle blocks were quickly washed with sterile phosphate-buffered saline (PBS, Hyclone), minced with ophthalmic scissors, digested in 0.2% Pronase at 37 °C for 1 h (Sigma-Aldrich), centrifuged at 1 500 ×g for 6 min to get the pellet. The pellets were sequentially suspended (Dulbecco's modified Eagle's medium supplemented with 15% fetal bovine serum, Hyclone), filtered (70-μm-mesh sieve, BD), span (800 ×g for 5 min) to isolate MuSCs. Using a Percoll gradient (90, 40, and 20%) (Sigma-Aldrich), we enriched isolated MuSCs in between 40% and 90% in the Percoll interface. Then the enriched MuSCs were subsequently validated by immunostaining with an antibody for Pax7 (Paired box 7, rabbit anti-Pax7, 1:100 dilution, Boster), a critical marker for MuSCs. Finally, the purified Pax7+ MuSCs were stored in liquid nitrogen.
Cell culture and transfection
Cells were in general cultured in a 5% CO2 atmosphere at 37 °C. MuSCs were initially seeded in 6-well (~2 × 105 cells per well) or 12-well (~1 × 105 cells per well) plates in growth medium (GM) that contains DMEM plus 10% fetal bovine serum (FBS, Gibco, USA) and 2% Penicillin & Streptomycin (Invitrogen, USA) solution, when amounted to 80%–90% confluency, GM was replaced by differentiation medium (DM) via reducing FBS from 10% to 2% to induce differentiation. The medium was refreshed every 2 d.
For the gain and loss function study, when cells at 80%~90% confluence, the GM was replaced with DMEM supplemented with 10% FBS. Then cells were transfected using Lipofectamine 3000 (Invitrogen, USA) with interfering RNA (si-NC, in-193b-3p and siIGF2BP1) or overexpression plasmid (pCtrl/pIGF2BP1) and chi-miR-193b-3p mimic (mi-193b-3p, RiboBio, China) at indicative concentrations, according to the manufacturer's direction. The transfected cells were kept in GM or replaced with DMEM supplemented with 2% FBS to induce differentiation and collected for RNA/protein assay at 48 h and immunofluorescence stained with EdU at indicative time points, or with MyHC (Myosin Heavy Chain) antibody at 7th d post differentiation.
Given that culturing cells are easily contaminated by mycoplasma, which leads to severely spurious results, we monitored and even employed polymerase chain reaction (PCR) to directly detect mycoplasma contamination (TRansgen Biotech, China) in culturing media before transfection and harvesting [63], to ensure cells were mycoplasma-free (Supp Fig.4B).
Reporter constructs and luciferase assays
To evaluate the targeting relationship between IGF2BP1 and miR-193b-3p, based on the potential MRE (miRNA recognition element) of miR-193b-3p within 3ʹ UTR regions of IGF2BP1 mRNA predicted with online software FINDTAR3 (http://bio.sz.tsinghua.edu.cn/) and BIBIServ2 (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/), a 470 bp-length fragment 3ʹ UTR regions of IGF2BP1 mRNA containing the wild-type (wt, GGCCGG) or mutant (mut, GTAAAG) were synthesized and cloned into the psiCHECK-2 vector (Promega) to generate IGF2BP1-wt and IGF2BP1-mut vectors (Sangon Biotech, China), respectively.
To detect the enhancer activity of miR-193b-3p, two fragments harboring goat miR-193b-3p (5ʹ -ggtaccGTTTATGTTTTATCCAACTGGCCCACAAAGTCCCGCTTTTGGGGTCATTCTAGACGGCGAGGGATTCAGctcgag-3ʹ) and miR-193b-5p (5ʹ-ggtaccGGAGGCTGTGGTCCCAGAATCGGGGTTTTGAGGGCGAGATGAGTTTATGTTTTATCCctcgag-3ʹ) were successfully amplified and subcloned into the pGL3 Promoter vector (Promega, USA) between the KpnI and XhoI sites. These constructs were cotransfected with pRLT-K (Promega, USA) encoding for the renilla luciferase gene to measure their transfection efficiency.
For the luciferase reporter assays, goat MuSCs (~1×104 cells per well), mouse C2C12 myoblasts (1 × 105 cells per well, Thermo, USA), and HeLa cells (~2 × 105 cells per well, ATCC, USA) were cultured in GM on 24-well plates and cotransfected with vectors (640 ng/well for each vector) using Lipofectamine 2000 reagent when cells were grown to 80 %–90 % confluence. After transfection for 48 h, the transfected cells were lysed, and the activities of firefly and Renilla luciferase were measured using a dual-luciferase reporter assay system (Promega, USA), according to the user’s guidelines.
Overexpressing and interfering plasmids construct
To produce IGF2BP1 and miR-193b-3p overexpressing vector, we amplified the coding sequence (CDS) of IGF2BP1 (XM_005693695.3) (forward primer 5ʹ-CCCAAGCTTATGAACAAGCTGTACATCGG; reverse primer 5ʹ - CCGGAATTCTCACTTCCTCCGGGCCTGGGC, 1734 bp)from cDNA and 371 bp region of the miR-193b-3p gene (forward primer 5ʹ - CCCAAGCTTACTGTTCTCCCGTCATTCC -3ʹ; the reverse primer 5ʹ - CCGGAATTCGTAGCAAACCTCCCCTCTT -3ʹ) from the goat genome. Then subcloned them into the pcDNA 3.1(+) vector separately by using double digestion with HindⅢ and EcoRI, and T4 DNA ligase (Invitrogen, USA) according to the manufacturer's guidelines. PCR combining with Sanger sequencing was performed to validate the target gene.
To provide solid interfering results for IGF2BP1, three small interfering RNA, including siRNA1, CAGCTCCTTTATGCAGGCT; siRNA2, CTCCTTTATGCAGGCTCCA; and siRNA3 CTTTATGCAGGCTCCAGAG, targeting goat IGF2BP1 mRNA were designed and synthesized in RiboBio (Guangzhou, China). We transfected them separately into MuSCs at two concentrations (50 nM and 100 nM) and then quantified IGF2BP1 mRNAs. The results suggest that IGF2BP1 levels are efficiently decreased at 100 nM for each siRNA (Supp Fig. 6), thus in the following experiment, we pooled them at 100 nM concentration. Besides, the miR-193b-3p miRNA mimic (mi-193b-3p) and control (mi-Ctrl), as well as inhibitor (in-193b-3p) and control (in-Ctrl) were ordered from RiboBio (Guangzhou, China).
RNA extraction and qPCR
Following the manufacturer's instruction, total RNAs were extracted from tissues or cultured cells using RNAiso Plus reagent (TaKaRa, Japan), and roughly qualified by using 1.5% agarose gels electrophoresis and NanoDrop 2000c Spectrophotometer. Then the qualified RNAs (~1 mg) were reversely transcribed into cDNA by using the PrimeScript™ RT reagent Kit with gDNA Eraser or miRNA PrimeScript RT reagent Kit (Takara, Japan) separately for mRNA or miRNA assay. Then according to the manufacturer's guide, RNA levels of target genes in these cDNA were accurately measured by using real-time PCR (RT-qPCR) in the Bio-Rad CFX96 system (Bio-Rad, USA) with SYBR Premix Ex TaqTM II (Takara, Japan). Each treatment performed at least triply three independent times, and each sample triplicates in qPCR. Moreover, to enhance the accuracy, three housekeeping genes in goat ACTB (Actin Beta), SDHA (Succinate Dehydrogenase Complex Flavoprotein Subunit A), and PGK1(Phosphoglycerate Kinase 1)) and mouse (ACTB, GAPDH, and Hprt (Hypoxanthine Phosphoribosyltransferase 1)) were used as an internal control. The 2−△△Ct or 2−△Ct methods were employed to calculate the relative RNA levels of target genes. The detailed information for primers was listed in Supplementary Table 1.
Western Blotting and Immunofluorescence for protein analyses
To analyze protein levels of the target genes via western blotting (WB), we extracted total proteins in lysed cells by using radioimmunoprecipitation assay (RIPA) (Beyotime, China). After quantified through the bicinchoninic acid (BCA) method (Beyotime, China), protein samples (~20 μg) were sequentially loaded for electrophoresis, transferred on polyvinylidene fluoride (PVDF) membranes (Millipore, USA), incubated with primary antibodies for IGF2BP1, MyoG, MyoD, and PAX3 (Abcam, UK) at 4 °C overnight and secondary IgG (Beyotime, China) for 2 h. After the addition of horseradish peroxidase (HRP) substrate, protein bands were exposed via electrochemiluminescence (ECL) (Pierce, USA) and analyzed by using Image Software. GAPDH (BOSTER, China) worked as a loading control.
For immunofluorescence assay, MuSCs (seeded in 3.5-cm Petri dishes with ~2 × 104 cells per dish) cultured in DM for 7 days were fixed with 4% paraformaldehyde (room temperature, 15 min), washed with 1 mL PBS (3 times), permeabilized with 1 mL 0.5% Triton X-100 (4 °C, 10 min), blocked in 1 mL 2% bovine serum albumin (37 °C, 30 min), incubated with anti-mouse Myosin heavy chain (MyHC) (1: 200, 4 °C, overnight) (R&D Systems, USA) and secondary antibodies Cy3_IgG (H + L) (1: 200, Solarbio, Shanghai, China) 37 °C for 2 h sequentially. Finally, 0.05μg/mL DAPI (4′, 6′-diamidino-2-phenylindole; Invitrogen) were added to cells and kept in the dark (37 °C for 10 min). Images were captured by using an Olympus IX53 inverted microscope (Tokyo, Japan), and then analyzed by using ImageJ software.
CCK-8 assay for cell proliferation
Cells were inoculated in 96-well plates with 2 × 103 cells per well initially (~ 30% confluency) and cultured in GM for 2 days, then transfected with different vectors according to protocols described above. Every 24 h, the absorbance value for each sample was measured at 450 nm by using a Microplate Reader (Model 680, Bio-Rad) after added 10 μL of Cell-Counting Kit-8 (CCK-8) reagents (Kumamoto, Japan) to the cells for 2 h.
EdU assays for cell proliferation
MuSCs (2 × 103 cells per well) were initially cultured and transfected the same as in CCK-8 assay. Twelve hours after transfection, primary myoblasts were cultured in GM consisting of 10 μM 5-ethynyl-2'-deoxyuridine (EdU; RiboBio China). Every 24 h, the cells were fixed (4% PFA at room temperature for 30 min), permeabilized (0.5% Triton X-100), incubated (1 × Apollo reaction cocktail for 30min), and then stained (1 × Hoechst 33342 for 30 min). Finally, we quantified the EdU-stained cells (ratio of EdU+ myoblasts to all) using randomly selected fields captured shortly after staining by employing an Olympus IX53 inverted microscope (Tokyo, Japan). Assays were performed at least three times.
Dual-labeled Fluorescence in Situ Hybridization (RNA-RNA FISH)
To detect the spatial localization of IGF2BP1 and miR-193b-3p RNA, the Cy5- labeled fluorescence oligonucleotide probes complementary to goat IGF2BP1 mRNA (5ʹ -GCCGGATTTGACCAAGAACTGGCCGCTGTAGGA-3ʹ, red) and FAM-labeled chi-miR-193b-3p probes (5ʹ -AGCGGGACTTTGTGGGCCAGTT-3ʹ, green) were synthesized (Servicebio, China). MuSCs proliferating for 2 d and differentiating for 7 d were rinsed with PBS (5 min), fixed in 4% DEPC-treated paraformaldehyde (room temperature, 10 min), permeated in PBS supplemented with 0.5% Triton (4 ℃, 5 min), and washed 3 times ×5 min with PBS (PH 7.4). Then the FISH experiments were performed in a dark environment with the following procedures. For each well, added 200 μL pre-hybridized solution (37 ℃, 30 min), hybridized with 8 ng/μL probe in 50 μL buffer (2× SSC, 10% formamide, 10% dextran sulfate) at 37 ℃ overnight. The cells were sequentially washed with a hybridized solution I, II, and III at 42℃ 3 times ×5 min, 1 time, and 1 time, and finally stained with 0.05μg/ mL DAPI (Invitrogen) at 37℃ for 10 min, washed with PBS 3 times ×5 min, and sealed with 25% glycerin.
Images were captured less than 5 h after hybridization by using Nikon DS-U3 in Nikon Eclipse Ti-SR and then analyzed by employing the CaseViewer software.
Nuclear-cytoplasmic fractionation
To accurately quantify expression levels of the target genes in the cytoplasm and nuclear separately, MuSCs proliferating for 2 d and differentiating for 7 d were fractionated into nuclear/cytoplasmic parts by using Nuclear/cytoplasmic fractionation & Nuclear RNA Purification Kit (Norgen Biotek, Canada), as described before [64]. In brief, the total RNA was separately extracted from both the supernatant (cytosol fraction) and pellet (nuclei), retro-transcribed into cDNA, and quantified targeted genes by using RT-qPCR. The nuclear-enriched U6 and cytoplasm-enriched 18S were used as control.
ActD analysis
According to methods described previously [65], we analyzed the effect of miR-193b-3p on IGF2BP1 mRNA stability by using actinomycin D (ActD, Sigma) to block newly mRNA synthesis. In general, MuSCs were cultured in 12-well (~1 × 105 cells per well) plates and separately transfected with miR-193b-3p mimic, mimic NC, inhibitor, and inhibitor NC for 24 h. Then cells were treated with actinomycin D (5 μg/ml) and harvested at 0, 60, and 120 min post-treated. The total RNA was extracted from each sample and finally, the remaining levels of IGF2BP1 mRNA were quantified by using the canonical RT-qPCR method. At least each treatment contained three independent biological repetitions.
mRNA-seq and bioinformatic analyses
Library preparation and poly(A) selection mRNA-seq was performed at Novogene Company (Beijing, China). Briefly, using NEBNext® UltraTM RNA Library Prep Kit Illumina®, qualified total RNA samples (200 ng) extracted from cells transfected with miR-193b-3p mimic or control (n=4 per group) were used to isolate polyA fraction (mRNA), following by fragmentation and generation of double-stranded cDNA. Libraries were sequentially evaluated by Qubit 2.0 Fluorometer, Agilent 2100 bioanalyzer, and RT-qPCR. Then qualified libraries were sequenced in Illumina HiSeq 2500 platform ((Illumina, USA) with a 2x150 bp pair-end.
The raw data of each sample were filtered to obtain the clean data (>8 Gb per sample), then amount to 97.09%~97.37% clean reads were quickly and accurately mapped onto the Capra_hircus _ARS1 reference genome (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/704/415/GCF_001704415.1_ARS1/GCF_001704415.1_ARS1_genomic.fna.gz) using HISAT2, among which as high as 93.94%~94.3% clean reads were uniquely mapped. The read count for each one was calculated using fragments per kilobase of transcript sequence per million base pairs sequenced (FPKM) value to evaluate gene expression. Differentially expressed genes (DEGs) between samples were canonically identified by DESeq2 R package vision 1.16.1 (|log2(FoldChange)| > 0 & padj < 0.05) [66].
Transcriptome clustering based on principal component analysis (PCA) indicates that miR_193b-3p mimics or control (mi-Ctrl)- treated cells are distinctly separated. Function Enrichment Analyses of DEGs, including Gene Ontology (GO) enrichment analysis and KEGG pathway, were implemented by using the DESeq2 with P-adj < 0.05 (adjusted via Benjamini-Hochberg) was considered significantly enriched.
Statistical analysis
Unless stated otherwise, data presented here are shown as mean ± SD (standard deviation) from at least triplicate independent samples or animals. The unpaired two-tailed t-test in Graphpad Prism 7 was employed to evaluate means’ difference, with significant threshold value set at ***P < 0.001,**P < 0.01, *P < 0.05, and § P < 0.1.