4.1 Materials
New Zealand white rabbits (4-5 months old, weighing 2.5-3.0 kg, provided by the Animal Experiment Center of Tongji Medical College); Chitosan (molecular weight~~21,000Da, deacetylation degree>95%, Jinan Haidebei Marine Biological Engineering, China), sodiumβ-glycerophosphate(Aladdin, USA), Acetic acid(chemical reagents of analytical grade, Sigma, USA), Type II Collagen (Shanghai Xiangduo Biological, China), Polylactic Acid (Sigma, USA) , ɑ-MEM medium (Gibco, USA), DMEM / F12 medium (Gibco, USA), fetal bovine serum (Gibco, USA), 0.25% trypsin (containing EDTA) (Gibco, USA), Live/Dead cell staining kit(Sigma, USA), type II Collagenase and trypsin (Sigma, USA), HE and Safranin O staining kit (Gibco, USA), anti-type II collagen antibody (Abcam, USA), goat anti-rabbit horseradish peroxidase IgG (Abcam, USA), SYBR® Green master mix (Applied Biosystems, Foster City, CA); Fluorescence inverted microscope (Olympus, Japan), Universal tensile testing machine(SANS CMT4000, MTS, China).
4.2 Fabrication of thermosensitiveCS-based hydrogels
Firstly, 2000 mg of CS powder was dissolved in 100 mL acetic acid (0.1 mol / L) and vigorously stir for 1h with 300 rpm to prepare a 2% solution. The solution were then passed through a gauze filter, sterilized by autoclave (121 °C, 15min) and stored at 4 °C; 25mg Col II was dissolved in 1.25mL acetic acid (0.1 mol / L) to prepare a 2% solution; 20mg PLA was dissolved in 1 mL chloroform solution to prepare a 2% solution; 5600mg GP powder was dissolved in 10 mL distilled water to prepare a 56% solution, which was sterilized by suction filtration. Secondly, the hydrogel was prepared by mixing CS with Col II and PLA at the ratio of 2: 1: 1; the pre-cooled GP was added dropwise to the mixed solution in the ice bath under constant stirring with 300 rpm to reach a final concentration of 6%. The CS/GP, CS/Col /GP hydrogels were prepared following the same steps above and served as controls.
4.3 Gelation time determination and mechanical characterization of CS-based hydrogels
The test tube inverting method was used to measure the gelation time at constant temperature of 37°C in a water bath. 1mL of each sample (n = 5) of hydrogel solution was added into test tubes at room temperature before incubated in water bath. The fluidity of the samples was observed every 30 s by tilting the tube. The time at which flow stopped was taken as the gelation time and the values were recorded.
Compression tests were carried out by a universal tensile testing machine. At least four specimens were tested for each group. Samples were cut into cubic specimens and compressed by two parallel metal platens. The state of the hydrogel samples was examined with crosshead speed of 2 mm/min until reaching 20% strain. Force and deformation data were collected by the test instrument and were converted to stress and strain values. The elastic modulus was calculated from the slope of the initial linear segment of stress–strain curves.
4.4 In vitro culture of BMSCs in CS-based hydrogels
The animal experiment was carried out in accordance with relevant guidelines and regulations, and was approved by the Medical Ethics Committee of the Puai Hospital affiliated to Tongji Medical College, Huazhong University of Science and Technology (number: KY-2020-106-01). Three New Zealand rabbits were sacrificed under general anaesthesia by injection of 30mg/kg sodium pentobarbital (1%) through the auricular veins. The femur and tibia were isolated under aseptic conditions and the muscles on the bone surface were removed. BMSCs were isolated as published previously[38]. BMSCs were cultured in DMEM supplemented with 10% FBS and 1% antibiotic-antimycotic solution (penicillin, streptomycin, amphotericin, and gentamycin) under standard cell culture conditions (37°C, 5% CO2, 95% humidity). The first medium change was performed after 24 h, and then the medium was changed every half a day for half a volume. BMSCs were passaged and expanded. All experiments were performed with passage 3 (P3) BMSCs.
The sterile hydrogels were prepared as previously mentioned in an aseptic environment and mixed with BMSCs suspension of appropriate amount reaching a final cell density of 2*105 cells/mL. They were placed in 24-well plates (0.5mL for each well). To induce thermal gelation, hydrogels were placed in an incubator at 37°C for 10 mins. After gelation, all the hydrogels were washed three times with cell culture medium every 30mins. 1 mL complete medium was added to each well and changed every 2 days.
4.5 Cell viability and proliferation assessments of BMSCs seeded in hydrogels
Cell viability seeded in hydrogels was evaluated using Live/Dead cell viability assay. After 3 days of incubation, cell-seeded scaffolds were washed in PBS for three times. Each constructs was immersed in 500uL of PBS with Calcein AM (0.05% v/v) and ethidium homodimer 1 (0.2% v/v) and incubated for 2h at 37℃. Samples were imaged using a fluorescence inverted microscope applying an excitation/emission wave length of 350/460 nm.
Cell proliferation was determined using the Cell Counting Kit-8 (CCK-8, Sigma-Aldrich, USA) on days 1, 2, and 3 of cell culture, following manufacturer instructions. 2D culture system was taken as control group. Briefly, cell culture medium of the samples (three replicates) was removed and 350μL fresh culture medium with 35μL CCK-8 reagent was added to each sample. After incubated at 37°C for 2 h, 100 μL medium of each well was transferred to 96-well plate. The absorbance values were measured using a microplate reader at wave length of 450 nm. The results obtained were expressed as optical density (OD) after blank subtraction.
4.6 Cartilage-specific gene expression analysis of BMSCs seeded in hydrogels
On days 21 of cell cultured in chondrogenic medium(DMEM, 10 μg/ml insulin, transferrin, selenium, 0.1 μM dexamethasone, 40 μg/mL proline, 50 μg/mL ascorbate-2-phopshate, 10 ng/mL TGF-β3), total RNA was collected from constructs by sequential use of Trizol and RNeasy mini kit plus, according to the manufacturer’s instructions. 500 ng total RNA was reverse transcribed into cDNA using SuperScript III first-strand synthesis kit (Thermo Fisher Scientific). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR® Green master mix on a StepOnePlus Real-Time PCR system (Applied Biosystems). GAPDH was used as the housekeeping gene. Relative genes expression (Sox9, Aggrecan, COL2A1) were assessed using the ΔΔCT method. Primer sequences are as follows: GAPDH (Forward: CAAGGCTGAGAACGGGAAGC; Reverse: AGGGGGCAGAGATGATGACC), Sox9 (Forward: CTGAGCAGCGACGTCATCTC; Reverse: GTTGGGCGGCAGGTACTG), Aggrecan (Forward: GCTACACTGGCGAGCACTGTAACAT; Reverse: GCGCCAGTTCTCAAATTGCATGGG), COL2A1 (Forward: GCTGGTGAAGAAGGCAAGA; Reverse: AGAACACGGACCACAAGGA).
The mechanical and biological properties were invested and compared for all hydrogels in order to select the most suitable hydrogel for in vivo studies.
4.7 Construction of rabbit cartilage defects models
24 New Zealand rabbits were randomly divided into four groups (N = 6 per group): A: normal group; B: control group; C: hydrogel group; D: hydrogel + BMSCs group. The hydrogel with best mechanical and biological properties was selected to take the in vivo studies. Normal group without any treatment was taken as comparison. The rabbits in B, C and D groups were anesthetized by injection of 30mg/kg sodium pentobarbital (1%) through the auricular veins. The knee joints were exposed via a medial parapatellar approach. The knees were flexed to expose the femoral articular cartilage, and a circular full-thickness defect in the articular cartilage was made using a 4.5-mm drill to create a 3-mm-deep hole extended into subchondral bone (Figure 5). The cartilage defect in the control group received no treatment; the hydrogel group was filled with the CS /Col/PLA/GP hydrogel; the hydrogel + BMSCs group was filled with CS /Col/PLA/GP hydrogel and BMSCs. The incision was sutured layer by layer after the hydrogel was solidified. All rabbits were given an injection of 80,000 U of penicillin after operation for three days and allowed to move freely in the cage. No pain killers were used after the surgery. The general conditions of the animals are observed and recorded daily.
4.8 Evaluation of efficiency of articular cartilage repair
At 8 weeks after surgery, the animals were sacrificed by injecting overdose chloral hydrate, and then the knee joints were harvested for further research.
(1) Gross morphology: The entire knees of each rabbit were dissected and the distal part of each femur was extirpated. The samples from each group were photographed and examined for evaluation according to the criteria proposed by the International Cartilage Repair Society (ICRS) [39].
(2) Histology and immunohistochemical staining: All specimens were fixed with 4% paraformaldehyde solution for 72 h. They were embedded in paraffin after dehydrated routinely, and cut into 5 μm thick sections. Sections were stained with hematoxylin-eosin (HE), safranin-0, and immunohistochemical staining of type II collagen. All specimens were observed using optical microscope.
4.9 Statistical analysis
All quantitative results were obtained from at least triplicate measurements. SPSS 18.0 statistical software was used for data analysis. The data were expressed as the mean ± standard deviation. Comparison between samples was carried out by analysis of variance. P value <0.05 was considered statistically significant.