Samples collection
We collected 32 pairs of fresh NSCLC samples and adjacent normal lung tissues from February 2016 to February 2020 at Fujian Provincial Hospital. This study was approved by the Medical Ethics Committee of Fujian Provincial Hospital and was conducted according to the Declaration of Helsinki. The written informed consent was also obtained from all participants.
Cell culture and transfection
Five NSCLC cell lines (H1650, H1975, H827, A549 and H1299) and human normal epithelial cell line (HBE) were purchased from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. RPMI-1640 (Thermofisher, USA) medium containing 10% FBS (Gibco, USA) was used to culture cells at the condition of 37℃ with 5% CO2 and saturated humidity. Targeting FANCI short hairpin RNA (shRNA) and UBE2T overexpression lentivirus were synthesized by Genepharma (Shanghai, China) and puromycin were applied for cells selection. Lipofectamine 3000 (Thermofisher, USA) was applied for cell transfection based on the manufacturer’s protocol.
Quantitative Reverse-Transcription PCR (qRT-PCR)
TRIzol reagent (ThermoFisher, USA) was applied total RNA isolation from NSCLC tissues and cultured cells. The qPCR-RT Master Mix Kit (Yeasen, China) was used for synthesizing cDNA according to the manufacturers’ instructions. For qRT-PCR, SYBR Premix Ex Taq™ II (Takara Biotechnology Co., Ltd.) and TaqMan Universal Master Mix II (ThermoFisher, USA) was employed. QRT-PCR was conducted on a Roche Light Cycler480 system (Roche Diagnostics, Inc.) in accordance with the manufacturer’s protocol. Then 2−ΔΔT method was used to calculate the relative expression of FANCI and UBE2T. β-actin served as an internal control. Primer sequences used in this study were showed in Table 1.
Table 1
Primer sequences (5'-3')
|
Gene
|
Primer sequences
|
FANCI F
|
CCACCTTTGGTCTATCAGCTTC
|
FANCI R
|
CAACATCCAATAGCTCGTCACC
|
UBE2T F
|
TTGATTCTGCTGGAAGGATTTG
|
UBE2T R
|
CAGTTGCGATGTTGAGGGAT
|
β-actin F
|
AGGGGCCGGACTCGTCATACT
|
β-actin R
|
GGCGGCACCACCATGTACCCT
|
Western blot
Precooled RIPA buffer (Beyotime, China) was applied to extract total protein from cells or tissues. BCA Protein Assay kit (Beyotime, China) was applied for protein density detection. Proteins were then separated by 10% SDSPAGE. Subsequently proteins were transferred onto PVDF membranes (Millipore, USA). 5% fat-free milk was employed to block the membranes at room temperature for 2h. After blockage, the bands were incubated with primary antibodies (anti-FANCI, ab74332; anti-UBE2T, ab179802; anti-E-cadherin, ab40772; anti-N-cadherin, ab76011; anti-Vimentin, ab92547) which were purchased from abcam (USA) at 4°C overnight following with corresponding secondary antibodies incubation for 1 h at room temperature. β-actin (ab8226, abcam, USA) was applied as the internal reference protein.
Cell proliferation
Cell proliferation was detected using CCK-8 (Dojindo, Japan). About 4×103 cells were seeded into each well (96-well plate) and maintained for the indicated times. Afterwards, 10 μl of CCK-8 reagent was added into each well for another 2h incubation. Finally, at 450 nm, the absorbance of each well was determined.
Cell migration
Cell migration was tested by transwell and wound healing assays. Around 5×105 cells mixed in 200 μl basal medium were added into the upper chamber and the lower chamber was supplemented with 500 μl total medium for transwell assay. Around incubation for 24h, 4% paraformaldehyde was used to fix ccells following with staining using 0.1% crystal violet (Beyotime, China) and finally observed under the light microscope (Olympus Corporation, Japan). Meanwhile, cells were firstly seeded into a 6-well plate for 24 h incubation for scratch assay. After that, a straight line through the bottom of plate was scratched and photos were took at immediately and 24 h later.
Flow cytometry
Cell cycle and apoptosis were determined via flow cytometry by using the Annexin V-APC/PI Apoptosis Detection Kit and Cell Cycle Detection Kit (Beyotime, China) in accordance to the manufacturer’s protocols which was described before(Wang X. et al. 2018).
Immunoprecipitation Analysis
After cell lysis, 10-20 μl lysis solution was collected as Input for further detection. The rest of cell lysates were treated with anti-UBE2T antibody at 4°C for 12-16h, Afterwards, protein A/G-Sepharose beads (MCE, China) were supplemented for incubation about 4 h and collected finally. After washed three times for obtaining the co-precipitated proteins, western blotting was subsequently conducted with anti-FANCI antibody as described before.
Coimmunoprecipitation (CO-IP)
Co-IP assay was conducted by employing the Crosslink Magnetic IP/Co-IP Kit (ThermoFisher, USA) based on the manufacturer’s instructions.
Mouse Tumor Xenografts
BALB/c nude mice (n=6, age:6-weeks, gender:female ) were purchased from Gempharmatech (Nanjing, China). Around 1×107 A549/sh-NC cells or A549/sh-FANCI cells were injected into the mice subcutaneous right flanks (n=3 per group). Tumor volume was recorded every week. 5 weeks later, mice were sacrificed for harvesting tumors. The Animal Care and Use Committee of Fujian Provincial Hospital approved the in vivo experiments.
Immunohistochemistry (IHC)
IHC staining was performed on mice tissue sections embedded in paraffin. Afterwards, the sections were treated with primary anti-FANCI (showed above). By comparison with entire tissue area, the positive staining score was defined as 0 (0%), 1(1–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%). If the staining score≥3, it was considered to be highly expressed.
Statistical Analysis
Data was analysed using GraphPad Prism 6.01 software (GraphPad, USA). Between two or more groups, the differences was assessed with student’s t-test or one-way analysis of variance (ANOVA), respectively. When p-value lower than 0.05, it was considered as statistically significant.