Microorganism and culture conditions
For maintenance, the fungus T. amestolkiae A795, deposited in the Centro de Investigaciones Biológicas (Madrid, Spain), was cultured in PDA (potato dextrose agar) plates at 28 °C. T. amestolkiae was then cultured in Mandels medium, as reported before [15], with 1% of Avicel as carbon source, for RNA extraction.
Escherichia coli DH5α (Invitrogen) was used for plasmid propagation. Cells were grown at 37 ºC, in LB medium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, and 15 g/L agar) containing 25 mg/L zeocin for selection of resistant colonies.
The heterologous expression of ΒGL-1 was performed using P. pastoris X33 strain (Invitrogen), previously grown in YPD medium plates (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose and 10 g/L of agar). The positive clones were screened in YPD containing 100 mg/L of zeocin as selection marker, and cultured for 2-5 days at 28 ºC. Recombinant protein was produced in YEPS medium (20 g/L peptone, 10 g/L yeast extract, 10 g/L sorbitol, and 100 mM potassium phosphate buffer, pH 6), with daily addition of 10 mL/L of methanol as inducer. Cultures were incubated for 9 days, at 28 °C and 250 rpm, taking samples daily to measure BGL-1 production. All experiments were performed in triplicate.
Nucleic acid isolation, enzyme mutagenesis and cloning in Pichia pastoris
The DNA sequence of bgl-1 was identified by performing a TBLASTN against the set of predicted proteins of T. amestolkiae, obtained in a previous work [13]. The gene sequences returned were used to run a local BLASTN against the assembled genome [13]. The presence of a signal peptide in the BGL-1 protein sequence was examined using the SignalP server. RNA was extracted from 7-day old T. amestolkiae cultures growing in 1% of Avicel using Trizol reagent [52]. The isolated transcripts were converted to cDNA by RT-PCR using the Superscript II Reverse Transcriptase according to the manufacturer’s instructions. PCR amplifications were performed in a thermocycler Mastercycler pro S (Eppendorf). The primers were designed based on the nucleotide sequence of the bgl-1 gene identified in T. amestolkiae genome (GenBank accession no. MIKG00000000), excluding the region corresponding to the signal peptide. Restriction sites for XhoI and NotI were included in the forward and reverse primers respectively (BG1FWXHOI: 5′- ATCTCGAGAAAAGACAAGAGGTGTACATCACGACT-3′, and BG1RVNOTI: 5′- ATGCGGCCGCATATCCCAGCCCATTCCTCGC -3′). The PCR protocol was: first, a denaturation step at 95 °C for 5 min, followed by 36 cycles of amplification: denaturation at 95 °C for 45 s, primer annealing at 55 °C for 45 s, and elongation at 72 °C for 2 min. A final extension step at 72 °C for 10 min was also carried out. The PCR product obtained in the last step was introduced in the pPICzα expression vector (Invitrogen), and it was used to transform P. pastoris X-33 strain. Before transformation, the vector was linearized with SacI (New England Biolabs). The lithium chloride method was used for transformation according to the manufacturer’s instructions. Transformed colonies were grown on YPD medium plates with zeocin as selection marker. Positive clones were screened with 4-methylumbelliferyl β-D-glucopyranoside as described in Méndez-Líter et al. [14].
Conversion of BGL-1 into the two glycosynthase variants
The plasmid pPICza containing bgl-1 gene was used to generate two new versions of the protein by directed mutagenesis, replacing the glutamic acid 521 by a glycine or a serine. The identification of the catalytic amino acids of BGL-1 was performed by alignment using clustal omega (see supplementary material, figure S3), with the BGLs sequences of the bacterium Clostridium cellulovorans, the fungus Trichoderma reesei and the termite Neotermes koshunensis, in which the nucleophilic amino acid were previously detected by crystallographic methods [53]. For the mutagenic PCR, the Expand™ Long Template PCR System (Roche) was used as described by the manufacturer. Primers BG1sfwSer (CCCTCGTCCTCAGCTCATTCGGTTTTCCCGTCTAC), BG1sRvSer (GTAGACGGGAAAACCGAATGAGCTGAGGACGAGGG), BG1sfwGly (CCCTCGTCCTCAGCGGATTCGGTTTTCCCGTCTAC) and BG1sRvGly (GTAGACGGGAAAACCGAATCCGCTGAGGACGAGGG) were used for serine and glycine replacements, respectively. After PCR reaction, the product was digested by DpnI (New England Biolabs), in order to hydrolyze the methylated parental. Both new vectors were cloned into P. pastoris with the same method used previously.
Production and purification of BGL-1 and BGL-1 glycosynthase variants
The selected positive P. pastoris clones were grown overnight in 250 mL flasks with 50 mL of YPD medium at 28 °C and 250 rpm to obtain the respective preinocula. Then, they were used for recombinant protein production in 2-L flasks with 400 mL of YEPS medium. Cultures were incubated at 28 °C and 250 rpm for 9 days with daily addition of 10 mL/L methanol. For BGL-1 purification, 1 L of 9 day-old cultures was harvested and centrifuged at 10,000 × g and 4 °C for 20 min. The supernatant was concentrated to 20 mL and dialyzed against 10 mM phosphate buffer (pH 6.0). BGL-1 was purified in a single chromatographic step using an FPLC system (Äkta), with a 5 mL QFF HiTrap cartridge (GE Healthcare) equilibrated with phosphate buffer 10 mM pH 6.0. Elution of the bound proteins was carried out by applying a 25 min-linear gradient from 0 to 0.3 M of NaCl in phosphate buffer pH 6.0 10 mM, at 2 mL/min. The column was then washed with 10 mL of 1 M NaCl in phosphate buffer pH 6.0 10 mM and re-equilibrated using 10 mL of the starting buffer. Fractions with β-glucosidase activity were dialyzed and concentrated. The glycosynthase variants of BGL-1 were purified using the same protocol.
Protein quantification, enzyme assays and substrate specificity
Protein concentration of the purified proteins was determined measuring 280 nm absorbance in a Nanodrop spectrophotometer (Thermo Fisher Scientific).
The β-glucosidase standard reaction was performed in a heating block at 60 °C and 1200 rpm, using 3 mM p-nitrophenyl-β-D-glucopyranoside (pNPG, Sigma) in sodium acetate buffer 50 mM, pH 4.0. The reaction was stopped after 10 min by adding 1.4% (w/v) Na2CO3, and the release of p-nitrophenol (pNP) was measured in a spectrophotometer at 410 nm. One BGL activity unit was defined as the amount of enzyme capable of releasing 1 μmol of pNP per min (the molar extinction coefficient of pNP is 15,200 M−1⋅cm−1).
Glucose tolerance was determined by measuring β-glucosidase activity in standard conditions but in the presence of 0.1 mM to 3 M glucose concentrations. Activity in reactions without glucose were considered as 100%. For Ki determinations, the concentrations of glucose used were 1, 1.25, and 1.5 M.
To prevent the activity loss when working with low enzyme concentrations, all enzymatic assays included 0.1% BSA, a protein that does not affect the catalytic activity of BGL-1 [54]. The kinetic constants of the purified BGL-1 were determined against pNPG over a range of concentrations from 10 μM to 5 mM, o-nitrophenyl-β-D-glucopyranoside (oNPG, 40 μM to 20 mM), cellobiose (80 μM to 40 mM), cellotriose (80 μM to 40 mM), cellotetraose (80 μM 40 mM), cellopentaose (40 μM to 20 mM), and cellohexaose (20 μM to 10 mM). The Km and Vmax parameters were calculated using SigmaPlot (Stat-Ease). These reactions were quantified by measuring the glucose released using the Glucose-TR commercial kit (Spinreact) according to the manufacturer's instructions. All reactions were carried out in sodium acetate 50 mM, pH 4.0, in a heating block, at 60 ºC, during 10 min at 1200 rpm. Then, the reactions were stopped by heating them at 100 ºC for 5 min.
Kinetic parameters were calculated for two transglycosylation experiments catalyzed by the BGL-1-E521G variant with D-glucosyl fluoride (a-GlcF) and pNPG as substrates. Each substrate was used in one experiment at a fixed concentration of 10 mM, and with varying concentrations in the other. When pNPG was examined, concentrations ranged between 500 mM and 12.5 mM. When calculating kinetic constants for a-GlcF, it was used in a range from 25 mM to 1 M.
BGL-1 activity towards cellobiose, sophorose, laminaribiose, and gentiobiose, was determined using 10 mM of the disaccharides in sodium acetate buffer 100 mM, pH 4.0, with the appropriate amount of enzyme. Reactions were performed for 10 min at 60 °C and 1200 rpm, and quantified by measuring the glucose released using the Glucose-TR commercial kit (Spinreact).
Physicochemical properties
The molecular mass of the native BGL-1 was determined by MALDI-TOF [15]. The isoelectric point (pI) was determined by isoelectrofocusing (IEF), after revealing the gel with 4-methylumbelliferyl-β-D-glucopyranoside [14]. The optimal pH was evaluated using pNPG as substrate, in a in 10 min-BGL standard reaction in Britton-Robinson buffer (100 mM) in a range from 2 to 10. The optimal temperature was assayed using also standard conditions but varying the temperature from 30-70 °C.
Screening for transglycosylation acceptors of BGL-1
Potential transglycosylation acceptors for the wild type BGL-1 were searched against a library of 70 compound through a preliminary screening carrying out recovery inhibition assays, as described in a previous work [21]. Those that produced reaction rates higher than the controls without acceptor were considered potential hits for transglycosylation. The complete list of the tested acceptors is: 1-butanol, 1-heptanol, 1-propanol, 2,4-dinitrophenol, 2,6-dihydroxynaphthalene, 2-butanol, 2-mercaptoethanol, 2-nitrophenyl β-D-glucopyranoside, 2-propanol, 3,3-diphenyl propanol, 4-cresol, 4-hydroxybenzyl alcohol, 4-methylumbilliferyl β-D-xylopyranoside, 4-nitrophenol, 4-nitrophenyl α-arabinopyranoside, 4-nitrophenyl α-D-glucopyranoside, 4-nitrophenyl α-D-rhamnopyranoside, 4-nitrophenyl β-D-fucopyranoside, 4-nitrophenyl β-D-galactopyranoside, 4-nitrophenyl β-D-glucopyranoside, 4-nitrophenyl β-D-xylopyranoside, l-arabinose, arabitol, ascorbic acid, catechol, cellobiose, cinnamyl alcohol, cyclohexanol, dulcitol, EGCG, ergosterol, ethanol, eugenol, ferulic acid, D-fructose, D-galactose, gallic acid, gentiobiose, D-glucose, glycerol, guaiacol, hydroquinone, hydroxytyrosol, myo-inositol, lactose, maltose, mannitol, D-mannose, melibiose, menthol, methanol, naphthol, phenol, propargyl alcohol, quercetin, raffinose, resveratrol, D-ribose, L-serine, sorbitol, sorbose, sucrose, L-threonine, L-trehalose, L-tyrosine, vanillyl alcohol, xylitol, D-xylose, α-tocopherol, β-sitosterol.
Transglycosylation reactions catalyzed by the glycosynthases. Analysis of the products
In these reactions, α-GlcF was prepared as previously described [55], and used as donor in every reaction. The efficiency of both glycosynthase variants (BGL-1-E521G and BGL-1-E521S) was first compared in reactions containing 10 mM pNPG, 10 mM α-GlcF, 0.4 mg/mL of the corresponding mutant enzyme, and 50 mM acetate buffer pH 4. The reaction mixture was incubated at room temperature for 16 h at 500 rpm, and then analyzed by HPLC as explained below.
Other potential acceptors tested were: p-nitrophenyl-β-D-xylopyranoside (pNPX), p-nitrophenyl-β-D-galactopyranoside (pNPGal), vanillin, hydroxytyrosol, gallic acid, and EGCG. The standard transglycosylation reaction contained 20 mg/mL of a-GlcF, 5 mg/mL of each acceptor and 1 mg/ mL of BGL-1-E521G in acetate buffer 50 mM, pH 4, with 0.1% of BSA, and it was performed at room temperature for 16 h at 500 rpm. The synthesis of glycosides was first checked by TLC in silica gel G/UV254 polyester sheets provided by Macherey–Nagel. The running solution was contained ethyl acetate/methanol/water in 10:2:1 (v/v) proportions. Substrates and glucosides were detected under 254 nm UV light.
Positive hits by TLC were also analyzed by mass spectrometry in a HCT Ultra ion trap, to identify the expected glycosylated products. 10 μL of the samples were introduced by direct infusion and ionized using electrospray ionization-mass spectrometry (ESI-MS) with methanol as ionizing phase in the positive reflector mode. After analysis, data were processed with the Masshunter Data Acquisition B.05.01 and Masshunter Qualitative Analysis B.07.00 software (Agilent Technologies). All the expected products were detected as sodium adducts of the molecules.
Finally, the most interesting glycosides were purified by HPLC, in an Agilent 1200 series LC instrument equipped with a ZORBAX Eclipse plus C18 column (Agilent). The column was first equilibrated in a mix of acetonitrile (ACN) and H2O with 0.1% acetic acid, with a flow of 2 mL/min, and the reaction products were separated isocratically in 8 min. The glycosides of pNPG and pNPGal, were purified with a proportion of 14:86 (v/v) ACN:H2O. For the pNPX glycoside this proportion changed to 20:80 (v/v) ACN:H2O and for the EGCG products it was 13:87 (v/v) ACN:H2O. In all cases, after isocratic elution, the column was washed for 3 min with 95:5 ACN:H2O, and the system was finally re-equilibrated to the initial conditions for 4 min. Every product peak was detected by monitoring the absorbance at 270 nm. The quantification of the peaks was done by comparing with a calibration curve of each non glycosylated parental. The fractions containing the glycosides were collected to be further analyzed by NMR to determine their structure.
The reactions conducted to determine the kinetic parameters of BGL-1-E521G were also quantified using the isocratic HPLC method as described above for the glycosides of pNPG and pNPGal.
Nuclear Magnetic Resonance
The structure and regiochemistry of the purified glucosides of EGCG, pNPG, pNPX and pNPGal synthesized by BGL-1-E521G was elucidated by NMR. The samples for the NMR analysis were prepared by dissolving the purified compounds in 500 μL of deuterated water (D2O). NMR spectra were acquired at 298 K, using a Bruker AVANCE 600 MHz spectrometer equipped with a cryogenic probe. 1D 1H NMR spectra, 1H-13C HSQC and HMBC experiments were acquired to assign all NMR signals. For 1D 1H, 1H-13C HSQC, and HMBC experiments, the zg, zgpr, hsqcedetgp, and hmbcgpndqf sequences were employed. A standard transglycosylation reaction (described before), without purification of the products, was also submitted to NMR analysis, in order to determine all the species that could be generated by the glycosynthase.
Besides, to determine the regioselectivity of the wild type enzyme, a reaction using the native BGL-1 was performed. It was composed of 3 mM of pNPG as donor and 13C-labelled glucose as acceptor, in 50 mM acetate buffer pH 4. The reaction was set directly in the NMR at room temperature.