Materials
An antibody against an anti-phospho-S216 peptide of ERα (αP-S216) was produced and evaluated by AnaSpec Inc (San Jose, CA). Iba-1 antibody and Antibody Diluent were purchased from WAKO; biotinylated goat anti-rabbit antibody and Vectastain ABC reagents from Vector Laboratory (Burlingame, CA); Mouse Cytokine Array Panel A and an anti-F4/80 antibody from R&D Systems, Inc.; an antibody against green fluorescent protein (HRP-conjugated) from Abcam; an anti-Iba-1 antibody from Gene Tex; an Alexa 594 anti-Rat antibody and DMEM/F12 media from Life Technologies; Fixation/Permeabilization Solution Kit (BD Biosciences, San Jose, CA). Trizol from Life Technologies; Direct-zolTM RNA kit from Zymo Research; RNeasy mini kit from Qiagen; MultiScribe Reverse Transcriptase from Applied Biosystems; an anti-GFAP antibody from STEMCELL Technologies; Precision Plus Protein Standards from Bio-Rad. All reagents are highest qualities commercially available.
Animals: Mice were maintained on a 12 hr light/12 hr dark cycle and fed with NIH-31 the Open Formula Autoclavable diet (Zeigler, PA) and water ad libitum. Ex3-ERα KO mice were generous gift from Dr. Korach’ lab. All research has been reviewed and approved by an Institutional Animal Care and Use Committee of NIEHS/NIH. LPS solution (1 mg/ml) was kept at -20°C and thawed just before intraperitoneal injection. All experiments were performed in accordance with relevant guidelines and regulations.
Generation ERα S216A KI (Esr1S216A) mice
A 5.1-kb left arm containing introns 2 and 3 and exon 3 and a 2.0-kb right arm containing intron 3 were amplified from genomic DNAs of C57B/6 were cloned into pCR-XL-TOPO (Thermo Fisher Scientific, MA). Codon serine 216 encoded by exon 3 in the left arm was changed to alanine by site directed mutagenesis. After digestion with restriction enzymes, these DNA arms were cloned into the targeting vector which carries two multi cloning sites, self-excising ACN cassette [30] and DT-A cassette. The ACN cassette contains a testis-specific promoter from the angiotensin-converting enzyme gene that drives the expression of the Cre-recombinase gene, and RNA pol II promoter was used to drive neomycin registrant (neor) gene as a selection marker, which allows to screen ES cells in the presence of G418. When chimeras those are born from theses targeted ES-cells containing the ACN cassette are bred for germline transmission, somatic cells derived from the ES cells retained the cassette, but self-excision occurred in all ES-cell-derived sperm, and as a result, the unexpected consequence due to the presence of Neo gene in chromosome can be avoided all together. Linearized targeting vector was electroporated into C57B/6 ES cells. The G418-resistant ES clones were screened by Southern blot analysis of KpnI- and BglI- digested genomic DNA with 5' and 3' external probes. BglI-digestion generated 12- and 8.3-kb bands for KI and WT, respectively, detected by using the 3’-genomic probes. These Southern probes were amplified from ES cell genomic DNA: 5' probe, 130966/131442 (tgcagctgcttcctactggcttgaatcatccataagatattaataagcaaacagtaaaaagatctgcggttggtaggggagttcaatactatgatgatgaaatggaaagtgatgggtaatagaataggaacaagaactggaagctttgagccaatgctctctaaggatcactaaaaagtaaagaaatcctatctgaggctgccagcctcagagctaagttatttagagtggaaaaagttggccaactcagatggactcaaaccaaggagccaatgttttgtgagttttatagccgatgtcatttacgaaccattaaaatattgtattcaatattaatgagggggaatagcagggaagggttatgaaatacgagctgaaaggaaagctaggcctttgaggggaggaccagtgagttcatgtggctttgctatttgggacatggtgggactatgaagcagggaaccaggagcttcctta; 3' probe, 139971/140460 (ctgaagagatggctcagtggttaagagcatccactgtttgctcttccagaggattctggttcaattcccagctctcacatagcagttaataactgtctgtaaactccagttcaagaggacctggcaccctcacacagacatacatgcaggcaaaacaccaatgcacataaaaataaatacatagtttaagaacttcaggctcacttagcaggctctgtgtacttgtagagatctgtttctttaatcttggggactcacctctgtccactcaagaggggctgtgctcacacttcttttcaaattagttttctctctctgagtgcattcatgtgaagagtaggaggaatactagaagagccacccatttcttcacaggattattttatttctgagatctttttagagatatgtctgatcctatccactcccagcaaatagtaagtctttgttctcaacatttccactcatgaccctctctagtctgtaacag). The positive ES clones were injected into C57BL/6 blastocysts. Male chimeras were bred to C57BL/6 females to establish germline transmission, and the resulting heterozygous mice were interbred to obtain homozygous wild-type and knock-in mice. Primers for genotyping by PCR used for 5' probe 5’-TGCAGCTGCTTCCTACTGGCTTGA-3’ and 5’-TAAGGAAGCTCCTGGTTCCCTGCT-3’; for 3' probe, 5’-CTGAAGAGATGGCTCAGTGGTTAA -3’ and 5’-CTGTTACAGACTAGAGAGGGT-3’
Primary cortical mixed glial culture
Primary cortical mixed glial cultures were prepared from brains of mice at postnatal day 1-3, as previously described [31, 32]. Cortices were isolated from brains from which meninges and blood vessels were removed using forceps. Cells were dispersed by dissociating tissues in DMEM/F12 media through trituration. Obtained cell suspension were plated on either 24-well plates or 96-well plates pre-coated in poly-D-lysine (20 μg/ml) at 1×105 cells/well or 5×104 cells/well. Cells were maintained in DMEM-F12 (1:1) media supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 μM non-essential amino acids, 50 U/ml penicillin, and 50 μg/ml streptomycin. Culture medium was changed every 3 days. To allow high yield of microglia in the culture, the cells were cultured for 2 weeks. The mixed glial cultures with a ratio of 20% microglia and 80% astrocytes were obtained [31].
Microglia-enriched cultures
Mouse microglia-enriched cultures were prepared from primary mixed glial cultures as previously described (1, 2). Mixed glia cultures were plated on 150 cm3 flasks pre-coated with poly-D-lysine (20 μg/ml) at 5 × 107 cells/flask and maintained in DMEM-F12 media changed every three days for two weeks. Then, matured microglia were shaken off at 180 rpm for 40 min and re-plated on glass-bottom culture dishes (MatTek, Ashland, MA, USA) pre-coated with poly-D-lysine (20 μg/ml) at 1×106 cells/well.
Immunohistochemical staining
Mouse brain was first perfused with cold PBS to remove bloods, from which sections (35 μm thick) were prepared. Brain sections were treated with 1% hydrogen peroxide for 10 min, incubated for 20 min with blocking solution (BSA 1%/Triton X-100 0.4%/Normal Goat Serum 4% in PBS) and incubated overnight at 4°C with rabbit polyclonal antibody against Iba-1 (1:4000) in Antibody Diluent. Stained sections were washed in PBS three times each for 10 min and incubated for 2 hr with PBS containing 0.3% Triton X-100 and a biotinylated goat anti-rabbit antibody (1:227). After washing three times with PBS, these sections were incubated for 1 hr with the Vectastain ABC reagents diluted in PBS containing 0.3% Triton X-100. Finally, these treated sections were incubated with 3, 3´-diaminobenzidine and urea-hydrogen peroxide tablets dissolved in water to visualize microglia. The nigral densities of the Iba-1 immunostaining were measured using ImageJ software. To quantify the Iba-1 staining of microglial cells in the substantia nigra, representative images of Iba-1-positive regions in the substantia nigra were captured at 40× magnification. A total of 100 microglia in each mouse were selected randomly, and the Iba-1 density was measured and normalize with size of area selected. One way ANOVA plus post hoc test with Bonferroni’s multiple comparisons test was used to analyze the difference between saline injected WT microglia vs. LPS-injected WT or LPS-injected ERα KI.
ELISA
Cells were harvested and centrifuged to collected cultured media at time points after LPS (Millipore) treatment. Cytokine and metabolite concentrations were measured by ELISA. IL-6, IL-10 and PGE2 ELISA kits purchased from R&D Systems. ELISA assays were performed according to the manufacturer’s instructions.
Cytokine antibody array: Mouse brains were homogenized in 500 μL of cold PBS containing protease inhibitor cocktail and 5 μL of Triton-X100 and centrifuged at 10,000 ×g for 5 min at 4ºC. Obtained lysates (300 μg) were subjected to cytokine protein array. Cytokine expressions were detected by a mouse cytokine antibody array, panel A kit according to the manufacturer’s instructions. Obtained spots were measured as densities by ImageJ software and showed in a graph. Cytokine mouse antibody array were performed according to the manufacturer’s instructions.
Double immunofluorescence staining
Immunofluorescence staining was performed as previously described [33]. Mouse mixed glia or enriched microglia cells were cultured on 35 mm bottom glass dishes, fixed with 4% formalin and blocked with a goat normal serum in PBS buffer for 20 min. For the first staining, these dishes were incubated with given antibodies such as an anti-ERα and P-S216 antibody for 30 min at room temperature. For the second staining, stained dishes were washed with PBS buffer and incubated with marker antibodies such as anti-Iba-1 and GFAP antibodies for 30 min at room temperature. Subsequently, after washed with PBS, these dishes were incubated with a goat anti-rabbit IgG secondary antibody, Alexa Fluor 488 and a goat anti-mouse IgG secondary antibody, Alexa 594 (1:500) (Thermo Fisher) mixture at room temperature for 1 hr in the dark. These stained cells were washed with PBS buffer and mounted with mounting medium containing DAPI (VECTASHIELD ®). Stained cells in glass bottom dishes were observed using Zeiss 710 confocal microscopy (Zeiss).
Flow Cytometry
To assess cell death, mixed glia cultures were stained with an anti-F4/80 antibody (1:50) for 30 min on ice and Alexa 594 anti-rat antibody (1:500), followed by staining by Annexin-V as previously described [34] and analyzed using FlowJo software. To asses IL-6 expression, mixed glia cells were stained with an anti-F4/80 antibody (1:50) for 30 min on ice and Alexa 594 anti-rat antibody (1:500), followed by fixation/permeabilization using Fixation/Permeabilization kit (BD PharmingenTM), washed in FACS buffer (PBS, 2% BSA, 0.1 mM EDTA, 0.1% sodium azide), collected by centrifugation and re-suspended in BD Perm/WashTM buffer. Then these cells were incubated with anti-PE-IL-6 antibody for 20 min on ice in dark. After washing, stained cells were suspended in 200 μL of FACS buffer for immediate measurements of fluorescence by Flow cytometer (LSRII, BD Bioscience). Mean fluorescence intensity (MFI) was quantified using the FACScan flow cytometer. The instrument used the FlowJo software for the analysis of the data.
Western blots
Mouse uteri or brains were homogenized in 50 mM Tris-HCl buffer saline (pH 7.6) containing 8 M urea and 1% SDS. After centrifugation, resulting supernatant was added to SDS sample buffer. Protein concentrations were determined by Bio-Rad protein assay (Bio-RAD, Hercules, CA). Proteins were separated on a SDS-PAGE and transferred onto PVDF membranes (GE Healthcare, Pittsburgh, PA). These membranes were blocked with 5% BSA or 5% skim milk in 50 mM Tris-HCl-buffered saline containing 0.1% Tween-20 (TBS-T), incubated with given primary antibodies, washed with TBS-T, incubated with HRP-conjugated secondary antibodies and visualized using WesternBright Sirius HRP substrate (Advansta, Menlo Park, CA).
RT-PCR
Total RNAs were extracted from of enrich microglial cells using Trizol and a Direct-zolTM RNA kit. An RNeasy mini kit was used to extracts RNAs from mouse brains according to these manufacturer’s instructions cDNAs were synthesized using MultiScribe Reverse Transcriptase. Real-time PCR was performed using an ABI prism 7700 sequence detection systems (Applied Biosystems) with following TaqMan probes (Applied Biosystems) used: human and mouse glyceraldehyde-3-phosphate dehydrogenase (Hs99999905_m1 and Mm99999915_g1) for an internal control, IL-1α (Mm00434228_m1), IL-1β (Mm00434228_m1), IL-6 (Mm00446190_m1), IL-10 (Mm00439614_m1) and iNOS (Mm00440485-m1). Primers used for Cox-2 were primer-L: CAAGACAGATCATAAGCGAGGA and –R: GGCGCAGTTTATGTTGTCTGT. Assays were performed with a 7900HT Fast Real-Time PCR System (Applied Biosystems).
Rotarod test
Rotarod test was conducted by Rotamex-5 (Columbus instruments, Columbus, OH, USA). Groups of 7 ERα WT and of 8 ERα KI males were trained for 4 consecutive days before they were tested at their 3- and 6-month of ages. Initial rotation of rotarod was set at 1 rpm and incrementally accelerated 1 rpm every 12 seconds. Retention times (latencies) on rotarod to fall off from the rotarod was measured three times for each mouse and averaged.
Statistical analysis
Statistical analyses were conducted with One- or Two -Way ANOVA plus post hoc test with Bonferroni’s multiple comparisons test or Tukey-Kramer’s multiple comparisons test. Values are presented as means ± S.E. or ± S.D.