Ethics statement
The experiments involving human being were approved by the ethics committee of The Second Affiliated Hospital of Jiaxing University and complied with the human medical research ethics in Declaration of Helsinki. All participants or their guardians provided signed informed consent prior to enrollment. Animal experiments were carried out according to the ethical standards of animal experiment system approved by the animal ethics committee of The Second Affiliated Hospital of Jiaxing University. Adequate measures were taken to minimize suffering of the included animals.
Bioinformatics analysis
The microarray data GSE83521 of GC-related circRNAs was obtained from Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/). The affy package in R software [13] was adopted for pre-processing and standardization of expression data in the dataset. The limma package [14] was utilized to screen differential circRNAs with |log2FC| > 1 and p < 0.05 as the screening criteria, followed by drawing of heat map of the differential circRNAs. The possible regulatory mechanism of circ_0001013 was further predicted by circinteractome website (https://circinteractome.nia.nih.gov/). The potential target genes of miR-136 were predicted by miRDB (http://www.mirdb.org/), StarBase (http://starbase.sysu.edu.cn/), microT (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=microT_CDS/), and mirDIP (http://ophid.utoronto.ca/mirDIP/). Differentially expressed gene analysis was performed based on GC samples of The Cancer Genome Atlas (TCGA) database using GEPIA tool (http://gepia2.cancer-pku.cn/#index). The jvenn tool (http://jvenn.toulouse.inra.fr/app/example.html) was utilized to obtain the intersection of predicted miRNA target genes and differentially highly expressed genes in GC. The survival curve was analyzed through KMplot tool (http://kmplot.com/).
Construction of vector and detection of circ_0001013 target gene by dual-luciferase reporter assay
The target gene of circ_0001013 was analyzed by biological prediction website (https://circinteractome.nia.nih.gov/), and dual-luciferase reporter assay was implemented to investigate whether miR-136 was the direct target gene of circ_0001013. The human target gene sequences were queried in Gen Bank (National Center for Biotechnology Information, Bethesda, Maryland, USA). According to the prediction results of the software, the sequences containing 3'-untranslated region (UTR) of miR-136 (potential target gene of circ_0001013) was designed. One-step Site-directed Mutagenesis was employed to construct reporter gene plasmid vectors containing miR-136-3'UTR wild type (Wt) and miR-136-3'UTR mutant type (Mut). Overexpression (oe)-circ_0001013 was co-transfected with miR-136-Wt or miR-136-Mut plasmids into cells for 24 hours. After 6 hours of conventional culture in 5% CO2 incubator at 37℃, the medium was replaced with fresh medium. After 48 hours of continuous culture, the cells were lysed. The 100 µL passive lysis buffer (PLB) was added into each well, shaken at low speed for 15 minutes, and stored at low temperature for use. Dual-luciferase reporter assay was operated as per the manuals of a dual luciferase reporter gene assy kit (E1910, Inner Mongolia Hangseng Biotechnological Co., Ltd., Inner Mongolia, China): 100 µL fluorescein assay reagent II was taken in a 1.5 mL eppendorf (EP) tube, and a Luminometer (TD20/20: Turner Designs, Sunnyvale, CA, USA) was initiated to predict for 2 seconds. The tube was supplemented with 20 µL cell lysis, mixed completely, and positioned in the Luminometer to determine Firely Luciferase (FLUC). Then the tube was added with 100 µL of 1 × Stop&Glo preparation to measure Rellia Luciferase (RLUC). The relative luciferase intensity was calculated by the ratio of RLUC/FLUC. According to RLUC/FLUC, the target sites of miRNA were determined.
Detection of dual luciferase activity
The target genes of miR-136 were analyzed by biological prediction website (http://www.targetscan.org/vert_72/). TWSG1 was confirmed to be the direct target of miR-136 by dual-luciferase reporter assay. The synthetic TWSG1 3'UTR gene fragment was constructed into pMIR-reporter (Promega Corporation, Madison, WI, USA). The mutation sites in the complementary sequence of the seed sequence were designed based on TWSG1 Wt and constructed into pMIR-reporter plasmid. The correctly sequenced luciferase reporter plasmids Wt and Mut were co-transfected with miR-136 into HEK-293T cells (Shanghai Beinuo Biology Co., Ltd, Shanghai, China) respectively. Cells were lysed after transfection for 48 hours. The luciferase activity was estimated by a Dual-Luciferase Reporter Assay System (Promega).
Sample collection
GC and adjacent normal tissues were obtained from patients who were diagnosed as GC and received surgical treatment in The Second Affiliated Hospital of Jiaxing University between 2016 and 2019. All patients had not received drug treatment before. A total of 70 pairs of tissue samples were freshly frozen in liquid nitrogen and stored at - 80℃.
Cell culture and transfection
Human 293T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM). Human normal gastric epithelial cells RGM-1 were cultured in DMEM (Thermo Fisher Scientific Inc., Waltham, MA, USA). Human GC cell lines MGC-803, SGC-790, MKN45 and HGC-27 were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium. All above medium were supplemented with 10% fetal bovine serum (FBS) (Gibco, Carlsbad, California, USA), 100 U/mL penicillin, and 100 mg/mL streptomycin. All cells were cultured in a 37℃ incubator with saturated humidity and 5% CO2.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from by Trizol (Shanghai Hailing Biotechnology Co., Ltd, Shanghai, China). The concentration, purity and integrity of RNA were determined using Nano-Drop ND-1000 spectrophotometry and 1% agarose gel electrophoresis. miRNA specific complementary DNA was synthesized using a TaqMan MicroRNA reverse transcription kit and miRNA specific reverse transcription primers from TaqMan MicroRNA Assay (Thermo Fisher Scientific Inc.). miR-136 expression was measured in the light of the protocols of TaqMan miRNA Assays (Thermo Fisher Scientific Inc.) and standardized by U6. As per the manuals of a reverse transcription Kit (Beijing TransGen Biotech Co., Ltd., Beijing, China), the cDNA template was synthesized by reverse transcription reaction in a PCR amplification instrument. The primers were synthesized by Beijing Genomics Institute (BGI, Beijing, China) (Table 1). The reverse transcription experiment was performed based on the directions of EasyScript First-Strand cDNA Synthesis SuperMix (AE301-02, Beijing TransGen Biotech Co., Ltd.). The reaction solution was taken for real-time fluorescent quantitative PCR on a real-time fluorescent quantitative PCR instrument (ABI 7500, ABI, Foster City, CA, USA) according to the instructions of SYBR®Premix Ex TaqTM II kit (Takara, Dalian, China). The 2-ΔΔCt was the multiple ratio of target gene expression between experimental group and control group.
Table 1
Targets | Seuences (5'-3') |
miR-136 F | ACUCCAUUUGUUUUGAUGAUGGA |
miR-136 R | UCCAUCAUCAAAACAAAUGGAGU |
U6 F | GCTTCGGCAGCACATATACTAAAAT |
U6 R | CGCTTCACGAATTTGCGTGTCAT |
circ_0001013 F | GGACCGAGTCAAGTCAAAGG |
circ_0001013 R | GGAGGCTGAGGCAGAAGAAT |
TWSG1 F | GCTGTGCTTACTCTAGCCATC |
TWSG1 R | TGAGGCATTTGCTCACATCAC |
GAPDH F | GGAGCGAGATCCCTCCAAAAT |
GAPDH R | GGCTGTTGTCATACTTCTCATGG |
Western blot analysis
Cells were lysed with Radio-Immunoprecipitation assay cell lysis buffer (P0013B, Beyotime, Shanghai, China) encompassing phenylmethylsulfonyl fluoride at the final concentration of 1 mM. The protein was quantified by a Bio-Rad DC Protein Assay kit (Guangzhou EWELL Bio-Technology Co., Ltd., Guangdong, China). Each sample was added with sodium dodecyl sulfate (SDS) buffer and boiled for 10 minutes. The samples were electrophoresed with 10% SDS-polyacrylamide gel electropheresis at 90 V for 30 minutes and at 120 V for 90 minutes. The protein was electroblotted from the gel onto a polyvinylidene fluoride membrane at 200 mA for 120 minutes. The membrane was immersed in 1 × Tris-buffered saline with Tween 20 (TBST) containing 5% skimmed milk powder and shaken at room temperature for 2 hours to block the nonspecific binding site. The membrane was probed with primary antibodies (Abcam, Cambridge, UK) to TWSG1 (ab218995, mouse, 1:1000) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ab8245, mouse-anti-human, 1:5000) at 4℃ overnight, followed by 1-hour re-probing with goat anti-rabbit Immunoglobulin G (ab6721, 1:20000, Abcam) secondary antibody. Next, the sensitized electrogenerated chemiluminescence was applied for development of the blots. The gray value of protein bands was measured using an Image J software (NIH free software, USA).
Scratch test
The cells in each group were cultured in a 6-well plate with a density of 2.5 × 104 cells/cm2. After 24 hours, the medium was sucked off, and a 10 µL sterilized disposable pipette was utilized to scratch. The cells were washed twice with PBS and then cultured in RPMI 1640 medium containing 10% FBS. The wound healing of cells at 0 hour and 48 hour was observed at the same location. Each group was set with 3 duplicated wells. The migration ability of GC cells was expressed by relative scratch width = (number of cells in scratch area at T24 - number of cells in scratch area at T0)/number of cells in scratch area at T0 × 100%.
Transwell assay
The apical chamber of Transwell (8 µm aperture, Costar, Cambridge, Massachusetts, USA) was coated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). After air drying, about 1 × 104 transfected cells were suspended in 200 µL serum-free medium and seeded into the apical chamber for invasion detection. The medium encompassing 10% FBS was added to the bottom chamber as a chemical attractant. The cells were incubated at 37 ℃ with 5% CO2 for 48 hours to detect invasion. After incubation, the cells in the apical chamber were removed with cotton swabs. The cells on the lower surface were fixed with methanol, stained with 0.1% crystal violet and photographed under a microscope (200×, Olympus, Tokyo, Japan).
Flow cytometry
Total 1 × 106 cells in logarithmic phase were fixed with 70% cold ethanol, mixed with 1 mL propidium iodide (PI) staining solution (Becton Dickinson, Franklin Lakes, NJ, USA; 50 µg/mL), and then placed in dark for 30 minutes. Cell cycle was determined by a FACS Calibur flow cytometer (Becton Dickinson). The above results were analyzed with professional software ModFit.
Total 1 × 106 cells in logarithmic phase were suspended in 1 × Annexin buffer. Cells were double stained with 5 µL Annexin-VFITC (Becton Dickinson) and 1 µL PI at room temperature in dark for 10 minutes. After mixing, the mixture was placed at room temperature in dark for 5 minutes. Cells were suspended with 300 µL of 1 × Annexin buffer. The apoptosis rate was detected by flow cytometry.
5-ethynyl-2’-deoxyuridine (EdU) assay
GC cells in the NC group and the short hairpin RNA (si)-hsa_circ_0001013 group were labeled with EdU. The method was implemented as per the protocols of EdU proliferation detection kit (CA1170, Solarbio, Beijing, China). After removing the supernatant, 100 µL medium containing EdU (30 µmol/L) was added to each well for 12-hour cell incubation. After discarding the medium, cells were fixed with 4% paraformaldehyde for 30 minutes. After discarding the fixative solution, the cells were incubated with 50 µL of 2 mg/mL glycine for 5 minutes. Then 100 µL Apollo® staining solution was added into cells in dark treatment, followed by nuclear staining with Hoechst33342 (Thermo Fisher Scientific Inc.). ImagePro software was applied for image acquisition and quantitative analysis.
Biotin coupled probe pull-down assay
The biotinylated probe sequence of hsa_circ_0001013 was 5’-FITC- GGACCGAGTCAAGTCAAAGG -3’. About 1 × 107 cells were lysed in lysis buffer and incubated with 3 µg biotinylated probe for 2 hours at room temperature. Cell lysates were incubated with streptavidin magnetic beads (Life Technology, Gaithersburg, MD, USA) for 4 hours to pull down the biotin coupled RNA complex. The magnetic beads were washed five times with lysis buffer. The bound miRNA in the pull-down complex was extracted with Trizol reagent and analyzed by RT-qPCR.
Biotin coupled miRNA capture
About 2 × 106 cells were lysed with 50 µm biotinylated miRNA mimics (GenePharma, Shanghai, China) at 50% aggregation state, and the sequence was GCCCTTCATGCTGCCCAG. After transfection for 24 hours, the cells were lysed in lysis buffer. A total of 50 µL washed streptavidin beads were blocked for 2 hours and then added to each reaction tube to pull down the biotin coupled RNA complex. All tubes were incubated at low speed (10 r/min) for 4 hours on a rotator. After that the beads were washed five times with lysis buffer, RNA specifically interacting with miRNA was recovered with Trizol LS (Life Technology). The abundance of hsa_circ_0001013 was assessed by RT-qPCR and agarose gel electrophoresis.
Northern blot analysis
Northern blot analysis was performed with a Northern blot Kit (Ambion, Company, Austin, TX, USA). In a word, the total RNA (30 µg) was denatured in formaldehyde and then electrophoresed in 1% agarose-formaldehyde gel. Then the RNA was transferred to Hybond-N + nylon membrane (Beyotime) and hybridized with biotin-labeled DNA probe. A biotin chromogenic assay kit (Thermo Fisher Scientific Inc.) was applied to detect the bound RNA. Finally, the membrane was exposed and analyzed by an Image Lab software (Bio-Rad, Hercules, CA, USA).
Fluorescence In Situ Hybridization (FISH)
The hsa_circ_0001013 sequence and miR-136 specific probe were adopted for FISH. In short, a cy5-labeled probe was specific for circ_0001013, and farm-labeled probe was specific for miRNA. The nuclei were stained by 4',6-Diamidino-2-Phenylindole. All procedures were carried out in the light of the manufacturer's manuals (GenePharma). All images were obtained on a Zeiss LSM880 NLO (2 + 1 with BIG) confocal microscope system (Leica Microsystems, Mannheim, Germany).
Mouse xenografts
MGC-803 cells (1 × 107) were subcutaneously injected into the left armpit of BALB/C nude mice (aged 4-6 weeks, weighing 18 g-22 g; 8 mice/group) to establish xenograft mouse model. After approximately 10 days, when the tumor volume reached about 100 mm3, si-circ_0001013 alone, miR-136 alone or both were injected into the tumors of mice every two days for two weeks. The tumor volume was measured every other day according to the formula V = (W2 × L)/2. The mice were euthanized by CO2 and weighed.
Immunohistochemistry
The specimens were fixed with 10% formaldehyde, embedded in paraffin, and sectioned continuously (4 µm). The sections were baked in a 60℃ oven for 1 hour. The sections were dewaxed with xylene and then dehydrated with gradient alcohol. The sections were immersed in 3% methanol H2O2 (Sigma-Aldrich, St Louis, MO, USA) for 30 minutes at 37℃. The sections were put into 0.01 M citrate buffer and boiled at 95℃ for 20 minutes. The sections were cooled to room temperature. Normal goat serum blocking solution was dripped onto the sections for 10-minute incubation at 37℃. The sections were probed with primary antibodies (Abcam) to TWSG1 (ab57552, rabbit anti-human, 1:200), Ki-67 (ab156956, mouse, 1:150), matrix metalloproteinase 9 (MMP9; ab38898, rabbit, 1:500) and CD34 (ab81289, rabbit, 1:2500) at 4℃ for 12 hours. Afterwards, the corresponding biotin-labeled goat anti-rabbit secondary antibody was added for 10-minute incubation at room temperature. Next, streptomyces ovalbumin working solution labeled with horseradish peroxidase (S-A/HRP) was added to the sections which were incubated at room temperature for 10 minutes. The sections were stained with diaminobenzidine and stored in a dark room at room temperature for 8 minutes. Sections were stained with hematoxylin, dehydrated, cleared, sealed, and observed under an optical microscope. A Nikon image analysis software from Japan was employed to count the positive cells. The number of positive cells was calculated in 3 equal area non-repeated fields in each section (200×). Criteria for judging immunohistochemical staining results: ABCF2 (positive staining was more than 25% of the cells), and obvious brown or brownish yellow granules appeared in the cytoplasm. Positive expression rate = positive cells/total cells.
Statistical analysis
SPSS 21.0 (IBM Corp. Armonk, NY, USA) was adopted for statistical analysis, with p < 0.05 indicating statistically significant difference. The measurement data were summarized as mean ± standard deviation. Paired t-test was used for comparison between cancer tissue and adjacent tissue, and unpaired t-test was adopted for comparison between other two groups. One-way analysis of variance (ANOVA) was applied for comparison among multiple groups, while repeated measurement ANOVA was utilized to compare the data at different time points, followed by Tukey's post-hoc test. Pearson correlation was conducted to analyze the relationship between the two indexes. Kaplan-Meier method was used to calculate the survival rate. Log-rank test was performed for univariate analysis.