Study organisms: The mosquito used for investigation was the A. aegypti, Liverpool Blackeye strain, a highly susceptible mosquito strain used predominately in research for Aedes sp. (Buxton & Mullen 1981). Although A. aegypti is just one of 28 different mosquito species reported to vector D. immitis, the relative expertise on this particular species limited us to its use as our study organism.
Mosquito maintenance: Aedes aegypti, originally obtained from the Filariasis Research Reagent Resource Center (FR3) (Michalaski et al. 2011), were raised under standard laboratory conditions – 27 °C, 80+5% relative humidity, and a 12:12-hour light diurnal cycle (Dharmarajan et al. 2019). Adult female mosquitoes were blood fed using artificial membrane feeder. One day prior to membrane feeding 50 female mosquitoes were transferred to ~500 mL plastic containers with mesh tops (henceforth ‘‘cages’’). Females were starved of sugar for 12 hours and deprived of water for four hours prior to blood feeding. Mosquitoes in each cage were allowed to feed for two hours or until repletion on a Parafilm membrane stretched over an inverted water-jacketed glass membrane feeder maintained at 40oC. Each feeder was filled with 200 uL of dog blood infected or uninfected with D. immitis. The dog blood was obtained from FR3.
Dirofilaria immitis detection
Prior to screening for D. immitis infection from mosquitoes, DNA from individual mosquito samples was extracted using a commercially available kit (QIAGEN, DNeasy Blood & Tissue Kit) and quality was confirmed using a nanodrop machine. All 62 mosquito samples were screened for D. immitis infection irrespective of whether they were fed on infected or uninfected blood by amplifying the COI gene (656bp) of the D. immitis mitochondrial DNA (Murata et al., 2003). Briefly, a 25µl reaction was set up comprising 1µl each of the COI-Forward (5’–TGATTGGTGGTTTTGGTAA–3’) and COI-Reverse (5’–ATAAGTACGAGTATCAATATC–3’) primers, 12.5µl of 2X mastermix (New England Biolabs), 2.5 µl DNA template and 8.5 µl of nuclease free water. For each cycle that was run, a D. immitis infected blood sample and nuclease free water were simultaneously included as positive and negative controls respectively. The PCR cycle comprises of an initial denaturation step at 940C for 5 minutes and 40 cycles of 940C for 1 minute, annealing at 500C for 2 minutes and extension at 720C for 3 minutes. A final extension at 720C for 5 minutes and an infinite hold at 40C.
Confirmation of amplification was done by loading the PCR products in a SYBR safe stained gel. Briefly, 2% gel was made by autoclaving a solution of 1X TAE buffer and molecular grade agar. SYBR safe stain (1 µl SYBR safe: 10 mL TAE buffer) was added to the agar solution, poured into a precast gel tray and allowed to cool. To load the samples onto the gel, 6 µl of PCR product was mixed with 4 µl of 6X dye and pipetted into the wells. Lastly, 5 µl of a low molecular weight DNA ladder was loaded onto the gel and the gel could run for 45 minutes at 100 V. Amplified PCR products were viewed using a Chemidoc gel imager (Supplementary data, Fig 1).
16S rRNA library preparation and sequencing
Six individual mosquito genomic DNA were pooled to make one biological replicate and five biological replicates each of D. immitis infected and uninfected pools were prepared for metagenomic analysis. PCR sequencing of the V1-V3 variable region of the bacterial 16S rRNA gene were amplified using barcoded primers 27F/519R as outlined by the 16S illumina’s MiSeq protocol (www.mrdnalab.com, Shallowater, TX, USA). Briefly, PCR was performed using the HotStarTaq Plus Master Mix Kit (Qiagen, USA) under the following conditions: 94°C for 3 minutes, followed by 30-35 cycles of 94°C for 30 seconds, 53°C for 40 seconds and 72°C for 1 minute, after which a final elongation step at 72°C for 5 minutes was performed. After amplification, PCR products were checked in 2% agarose gel to determine the success of amplification and the relative intensity of bands. Multiple samples were pooled together in equal proportions based on their molecular weight and DNA concentrations. Pooled samples were purified using calibrated Ampure XP beads. Then the pooled and purified PCR product were used to prepare Illumina DNA library. Sequencing was performed at MR DNA (www.mrdnalab.com, Shallowater, TX, USA) on a MiSeq following the manufacturer’s guidelines.
Microbiome analysis
Sequence analysis was done using the Quantitative Insights into Microbial Ecology (QIIME 2), unless stated otherwise. Briefly, processing of raw fastq files were demultiplexed. The Atacama soil microbiome pipeline was incorporated for quality control of demultiplexed paired-end reads using the DADA2 plugin as previously described. Sequence alignment and subsequent construction of phylogenetic tree from representative sequences was done using the MAFFT v7 and FasTree v2.1 plugin. Operational taxonomic assignment was done using the qiime2 feature-classifier plugin v7.0 which was previously trained against the SILVA 132 database preclustered at 99%. Raw data from this analysis were submitted deposited and assigned the GenBank BioProject number # PRJNA606536.
Data analysis
Analysis of microbial abundances was done using the Microsoft Excel Windows version 2016 (Microsoft Corporation, Redmond, WA). Box plots were generated using GraphPad Prism (v8). Kruskal-Wallis test of one-way ANOVA was used to test the significance of alpha-diversity between infected and uninfected mosquitoes. Beta (between group) diversity was estimated using PERMANOVA analysis of unweighted UniFrac and Bray_Curtis metric. Unweighted UniFrac metric accounts for the presence or absence of individual taxa whereas the Bray_Curtis metric estimates the level of microbial dissimilarity between the infected and uninfected mosquitoes.