Polymerase chain reactions (PCR):
Reactions were performed with reagents from New England Biolabs: Phusion High-Fidelity DNA polymerase (M0530S), 5 x Phusion HF buffer (B0519S) and dNTP mix (N0447S). Cycling conditions are identical to those previously published [4, 13].
-1st PCR: template for sgRNAs; two 20 µl reactions per target
1 μl G00 primer (0.5 μM)
4 μl 5 x Phusion HF buffer
0.5 μl dNTP mix (250 μM)
1 μl sgRNA primer (0.5 μM)
0.2 μl Phusion High-Fidelity DNA polymerase (0.4U)
13.3 μl H2O
-Program: 1) 30’’, 98 °C
2) 10’’, 98 °C
3) 30’’, 60 °C
4) 15’’, 72 °C
5) go to step 2, 35 cycles in total
6) 10’, 72 °C
7) hold at 10 °C
-2nd PCR: template for resistance gene; two 40 µl reactions per resistance gene
2 μl 60 ng pPOTv7 mNG (hygro or G418) plasmid
8 μl 5 x Phusion HF buffer
1 μl dNTP mix (250 μM)
2 μl Upstream forward primer (0.5 μM)
2 μl Downstream reverse KO/TAG primer (0.5 μM)
0.4 μl Phusion High-Fidelity DNA polymerase (0.4U)
24.6 μl H2O
-Program: 1) 5’, 94 °C
2) 30’’, 94 °C
3) 30’’, 65 °C
4) 2’30’’, 72 °C
5) go to step 2, 40 cycles in total
6) 10’, 72 °C
7) hold at 10 °C
DNA purification after PCR:
PCR reactions were pooled and extracted with 1 volume water-saturated phenol (pH 8), followed by extraction with 1 volume chloroform. DNA was precipitated from the aqueous phase by addition of 0.1 volume 3 M sodium acetate, pH 5.2, and 3 volumes ice-cold ethanol. The DNA was pelleted by centrifugation, washed twice with 1 ml 80% ethanol, air-dried at room temperature, dissolved in 40 µl Milli-Q-water and stored at -20 °C until transfection.
Primers:
G00: aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac
PDEB1 3' sgRNA primer:
gaaattaatacgactcactataggTGAAGAAGTCAGTTGACCGGgttttagagctagaaatagc
Trypanin 5' sgRNA primer:
gaaattaatacgactcactataggCAAAAACGAGAAGAGCCTACgttttagagctagaaatagc
Trypanin 3' sgRNA primer:
gaaattaatacgactcactataggAGGTGTTGTGGTTCACACGTgttttagagctagaaatagc
GPI8 5' sgRNA primer:
gaaattaatacgactcactataggCGGTTGCAAAAAACGAATGCgttttagagctagaaatagc
GPI8 3' sgRNA primer:
gaaattaatacgactcactataggGGTATGTCCCATCAGTTGGAgttttagagctagaaatagc
Trypanin upstream forward primer:
TACTTTTCAGACTGCATCGTGGCGTACCCCgtataatgcagacctgctgc
Trypanin downstream reverse KO primer:
CTGCAACAAAGCCGTAACTTGGAACAACCAccggaaccactaccagaacc
PDEB1 downstream forward primer:
ACGAGTTCTGGCAACAACAGCAGTACTCGTggttctggtagtggttccgg
PDEB1 downstream reverse TAG:
ATCACCATTGACAAGAACGTACATCTACCAccaatttgagagacctgtgc
GPI8 upstream forward primer:
TTGGATCAGGCGCTTGCATATTTATTTCCAgtataatgcagacctgctgc
GPI8 downstream reverse KO primer:
AGTTTCAGGAAGGAAGTTCGTTTTTCTCCTccggaaccactaccagaacc