Mosquito species
Aedes albopictus strains used in the present study were maintained in the bio-secure insectary of the Insect Pest Control Laboratory (IPCL), Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, Seibersdorf, Austria. The non-infected mosquito strain used in the experiment was reared and maintained following the FAO/IAEA guidelines [22]. In brief, mosquito strains were kept under standard laboratory conditions at a temperature of 27 ± 1 °C, 60 ± 10% relative humidity, and a photoperiod of 12:12 (L:D) h including dusk (1 hour) and dawn (1 hour) transitional periods [22, 23]. Adults were kept in standard 30 × 30 × 30 cm Bugdorm cages (Megaview Science Education Services Co. Ltd., Taichung, Taiwan) in an insectary deprived of natural light and continuously supplied with 10% wt: vol sucrose solution. Before total RNA extraction, adults were starved for 12 h to empty stomach content and stored at -80 °C.
Virus-infected Mosquito Samples
The project ‘Research infrastructures for the control of vector-borne diseases’ (lnfravec2, https://infravec2.eu/) provided Aedes aegypti, strain BORA, infected with CHIKV and ZIKVs, and Culex pipiens strain Gavà, infected with WNV and USUV viral strains. In brief, 5-7-day old females of the Ae. aegypti strain BORA were infected with CHIKV and ZIKV by feeding on an infectious blood-meal with virus titers of 1.5 × 107and 1.02 × 107 plaque-forming units (PFU)/ml respectively. Virus titration was performed by the plaque assay for CHIKV and ZIKV and expressed in PFU/ml as previously described [24, 25]. A Hemotek® system was used for feeding the adult females and engorged females were fed with 10% sucrose in a chamber incubated at 28 °C and 80% humidity for 14 days in the bio-secure insectary of the Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution et Contrôle, Institut de Recherche pour le Développement (IRD), Montpellier, France. In addition, Cx. pipiens females inoculated with WNV and USUV were prepared at the Centre de Recerca en Sanitat Animal, (Campus of Autonomous University of Barcelona) Barcelona, Spain. Culex pipiens females were inoculated intrathoracically with 1–2 µl per adult using a stock of WNV (7,52 log10 TCID50/ml) and USUV (6,88 log10 TCID50/ml). Virus titers were determined by a standard limiting dilution assay [26] using monolayers of cells employed for virus propagation. Viral titers were expressed in 50% tissue culture infectious dose (TCID50) per ml. Injected females were kept at 28 °C and 80% humidity for 7 days. Bodies and heads were separated in individual tubes and homogenized in 500 µl of TRIzol and kept at -80 °C. Infected heads and bodies were delivered to the IPCL for RNA extraction and further analysis. The level of infection of infected mosquito bodies was estimated by evaluating the virus infection titer in the corresponding head using quantitative RT-qPCR. Only bodies of which the corresponding head showed high virus titer were considered infected and were used in spiking the non-infected mosquito samples.
Spiking Non-infected Mosquito Samples With Virus Infected Mosquitos
To determine the ability of the quantitative RT-qPCR assays to detect MBV, a single virus-infected mosquito Ae. aegypti infected with CHIKV or ZIKV and Cx. pipiens infected with WNV or USUV, was homogenized within large pools of uninfected adult mosquitoes, i.e. n = 165 (100 mg), n = 320 (200 mg) and n = 600 (1000 mg) and total RNA extracted. A pool consisting of only uninfected mosquitoes was included as a negative control. Negative control, 320 and 1600 mosquito pools were replicated twice.
Total Rna Extraction
Total RNA was extracted from mosquitoes using TRIzol™ Reagent (Invitrogen, CA, USA) according to the supplier’s instructions. After grinding and homogenizing mosquito adult pools using liquid nitrogen, TRIzol reagent containing one single infected mosquito was added to the mosquito pool and the RNA extraction was carried out according to the supplier’s instructions. For the negative control pool, TRIzol reagent was added after liquid nitrogen grinding. The total RNA pellet was resuspended in 20–1000 µl of RNase-free water and the volume was adjusted according to the mosquito pool size. The RNA samples quantity and quality were determined using Synergy™ H1 microplate reader (BioTek). The RNA samples were diluted to 10, 1, 0.1, 0.01, 0.001, 0.0001 ng/µl as a concentration that will consistently give the same amount per well in the RT-qPCR and were stored at -80 °C.
Evaluation Of Primers And Probes Specificity
To investigate the possibility of using multiple primers and probes sets to detect several viruses in the same reaction, we tested the specificity of each primers and probe sets to detect other MBVs. The total RNA extracted from uninfected mosquitoes was tested to ensure that there were no false positives caused by cross-reactions with the host-species. This step also determined any background signal generated due to primer cross-reactivity with mosquito-derived RNA.
Generation Standard Curves For The Rt-qpcr
To obtain a sustainable positive control for the detection of MBVs, the RNA sequences containing and flanking the sequence regions of the virus specific primers and probes of CHIKV, ZIKV, WNV and USUV were amplified using the primers listed in Table 1 and cloned into pGEM-T vector (Promega, USA). The SuperScript® III First-Strand Synthesis System for RT-qPCR (Invitrogen) was used to synthesize first-strand cDNA from purified poly(A) + or total RNA following the supplier’s instructions. The targeted sequences were amplified by Taq PCR Master Mix (Qiagen) with the following PCR conditions: 5 min 94 °C, 35 cycles of 30 seconds 94 °C, 30 seconds 58 °C and 1 min 72 °C, and 10 min 72 °C. The PCR product was purified using the High Pure PCR Clean-up Micro Kit (Roche, Germany) and ligated to the pGEM-T vector (Promega, USA), following the supplier’s instructions. The recombinant plasmids were transformed into DH5α competent bacteria (Invitrogen) following the supplier’s instructions. The recombinant plasmids and the inserted sequences were confirmed by Sanger sequence (Eurofins Genomics) with the universal vector primers M13F_uni (-21) TGTAAAACGACGGCCAGT and M13R_rev (-29) CAGGAAACAGCTATGACC. Recombinant plasmids were amplified, and the quantity and quality were determined using Synergy™ H1 microplate reader (BioTek). The DNA copy number was estimated using NEBioCalculator (https://nebiocalculator.neb.com/#!/dsdnaamt), then seven concentrations with known DNA copy numbers/µl were prepared by serial dilutions and used to estimate the virus copy number in infected and non-infected mosquito samples. Sterile, nuclease-free water was used as a no template control (NTC), then tested in triplicates.
Table 1
Primers for viral cloning in pGEM-T vector
Oligo Name | Sequence (written 5' − 3') | Size bp | Genome position | Reference accession |
Usu_9814F | GTGCCTTTCTGCTCAAACCA | 585 | 9814–9833 | AY453412 |
Usu_10398R | CAAAACCCTGTCCTCCTGGAC | 10378–10398 |
ZIKV_816F | CAAGAGAATACACRAAGCACTTGA | 539 | 816–839 | AY632535 |
ZIKV_1365R | ATGCTCTTCCCGGTCATYTTCT | 1344–1365 |
CHIKV_645F | GTGCCTACCCCTCATACTCG | 553 | 645–664 | NC_004162 |
CHIKV_1198R | CCGTTGCGTTCTGCCGTTA | 1180–1198 |
WNV_10533F | AAGTTGAGTAGACGGTGCTG | 340 | 10533–10552 | DQ211652 |
WNV_10873R | TTCCCCTGACCTACAGCTTC | 10854–10873 |
DENV2_1312F | TAACACCTCACTCAGGRGAAGAG | 309 | 1312–1334 | MG189962 |
DENV2_1621R | TGGGGATTTTTGAAAGTGACCAATG | 1597–1621 |
One-step Real-time Rt-qpcr
Mosquito-borne viruses specific primers and Taqman probes previously reported to detect each specific virus were synthesized by Eurofins Genomics with 5-FAM, HEX as the reporter dye for the probe. The details of the used primers and probes sequences and characteristics are shown in Table 2. The real-time RT-qPCR assay was performed using a CFX96 Real-Time System cycler (Bio-rad) and the Quantitect Probe RT-qPCR kit (Qiagen, Heiden, Germany). Reactions were performed in a 20 µl volume mixture containing 1 µl of diluted RNA template, 10 µl of 2x QuantiTect Probe RT-qPCR Master Mix, 8 µM of Forward primer, 8 µM of Reverse primer, 2.5 µM of probe, 0.25 µl of QuantiTect RT Mix, 5.95 µl RNase-free water. The amplification of the cDNA and the quantification of the viral copy number was done in one step using the following protocol: a single cycle of reverse transcript for 15 min 50 °C, 15 min 95 °C and 40 cycles of 15 s 95 °C and 1 min 60 °C. The real-time data was analysed using the CFX manager software provided by Bio-rad. Negative and positive controls were included in all PCR reactions performed. A sample was determined empirically to be positive if the CT value was 36, based on background cross-reactivity of the primers and probes in non-template control reactions. The amount of infectious RNA transcripts per reaction corresponded to the known PFU per reaction and is expressed as equivalent PFU [16, 27, 28]. Positive results were determined according to the amplification cycle at which the fluorescence was detected above the threshold cycle (CT) relative fluorescence unit (RFU) in the PCR baseline-subtracted RFU. Baseline thresholds for the four fluorophores were determined with the CFX manager software in a series of reactions using the virus standard dilutions and then set for subsequent runs as auto calculated [29].
Table 2
Nucleotide sequences of primers and probe used in RT-qPCR assays
Oligo Name | Sequence (written 5' − 3') | Modification | Genome position | Reference accession | Reference |
5` | 3` |
Usu_F | CAAAGCTGGACAGACATCCCTTAC | | | 10189–10212 | AY453412 | |
Usu_R | CGTAGATGTTTTCAGCCCACGT | | | 10270–10291 | [17] |
Usu_Probe | AAGACATATGGTGTGGAAGCCTGATAGGCA | 6FAM | TMR | 10226–10255 | |
ZIKV_F | CCGCTGCCCAACACAAG | | | 1191–1208 | AY632535 | |
ZIKV_R | CCACTAACGTTCTTTTGCAGACAT | | | 1245–1268 | [18] |
ZIKV_Probe | AGCCTACCTTGACAAGCAGTCAGACACTCAA | 5'-FAM, | 3'-TAMRA | 1213–1243 | |
CHIKV874 | AAAGGGCAAACTCAGCTTCAC | | | 874–894 | NC_004162 | |
CHIKV961 | GCCTGGGCTCATCGTTATTC | | | 942–961 | [15] |
CHIKV899-probe | CGCTGTGATACAGTGGTTTCGTGTG | 5'-FAM | 3'-BHQ1 | 899–923 | |
WN3′NC-F | CAGACCACGCTACGGCG | | | 10,668–10,684 | DQ211652 | |
WN3′NC-R | CTAGGGCCGCGTGGG | | | 10,770–10,756 | [16] |
WN3′NC-probe | TCTGCGGAGAGTGCAGTCTGCGAT | 5'-FAM | TAMRA | 10,691–10,714 | |
DEN-2F | CAGGTTATGGCACTGTCACGAT | | | 1417–1438 | MG189962 | [27] |
DEN-2C | CCATCTGCAGCAACACCATCTC | | | 1473–1494 |
DEN-2 probe | CTCTCCGAGAACAGGCCTCGACTTCAA | 5'-HEX, | 3'-BHQ1 | 1445–1471 |