- coli isolation and culture conditions
A total of 300 fecal samples were collected from Imam Khomeini hospital, Tehran, Iran, from August 2018 to January 2019. Clinical samples were at first plated onto 5% sheep blood agar and MacConkey Agar (Biolife Laboratories, Milano, Italy). Samples were then confirmed as E. coli based on their morphology, Gram-staining, and routine biochemical tests, including MR/VP, utilization of citrate, presence of lysine decarboxylase and urease enzymes, and the production of ornithine. A single colony was obtained from each sample and maintained in TSB medium (Invitrogen, Paisley, Scotland) with 30% sterile glycerol at –80°C for future experiments.
Primer design and polymerase chain reaction
To confirm the presence or absence of eae, flu, luxS, and ctx-M genes, specific primers were designed using Primer-BLAST (Table 1). Total genomic DNA of E. coli isolates were extracted using DNA Extraction kit (Roche, Mannheim, Germany) according to the recommended protocol by the manufacturer. To investigate the presence of eae, flu, luxS, and ctx-M genes, the PCR assay was performed in a DNA thermal cycler (Bio-Rad, USA) in a volume of 25 μl according to the following reaction conditions: initial denaturation step at 94 °C for 5 min; 33 × denaturation at 94 °C for 30 s; annealing at 60 °C for 30 s; and extension at 72 °C for 30 s, and final extension at 72 °C for 5 min. No template control (NTC) was used as a negative control. Finally, amplicons were observed following gel electrophoresis, and sent for sequencing after purification.
Table 1. Characteristics of the primers used in this study
Reference
|
Product size
|
Sequence (5’ à 3’)
|
Target gene
|
This study
|
73 bp
|
F; ACTAACTTCCAGTTCCGCCG
R; AGTCGCTTTAACCTCAGCCC
|
eae
|
[25]
|
113 bp
|
F; ACCGCCGATAATTCGCAGAT
R; TGCTTATCGCTCTCGCTCTG
|
ctxM
|
[26]
|
124 bp
|
F; ACGGTAAATGGCGGACTGTT
R; CACGGATGGTCAGGGTATCG
|
flu
|
[27]
|
113 bp
|
F; GTGCCAGTTCTTCGTTGCTG
R; GAACGTCTACCAGTGTGGCA
|
luxS
|
[28]
|
190 bp
|
F;CATTGACGTTACCCGCAGAAGAAGC
R; CTCTACGAGACTCAAGCTTGC
|
16srRNA E. coli
|
This study
|
165
|
F;AAAAGACATTGCCACCCCCA
R;GGACCGATTTCAACAACGCC
|
16srRNA B. coagulans
|
This study
|
108
|
F;TGTTGATCACGCGGAAGTGA
R;AATGCCACGACCTTTTTCGC
|
16srRNA B. subtilis
|
F: Forward; R: Reverse
Isolation of spore-forming probiotics from gastrointestinal tracts of broilers
A total of 10 broilers aged 6-12 months that did not take any antibiotics or probiotics during their life time were chosen. After slaughter in sterile conditions, intestinal contents were collected and diluted 1:1 (wt:vol) in buffered peptone-water (Oxoid) and resuspended by vigorous vortexing until obtaining an evenly distributed suspension. Then, aerobic spore-forming isolates were selected by heat (80 °C) and ethanol treatment. Ethanol treatment was performed by diluting the primary suspension (1:1) in ethanol (final concentration, 50% vol/vol) and incubation at room temperature for 1 h. 0.1-ml aliquots were cultured on nutrient agar plates and incubated at 37°C for 24-48 h. Colonies were picked randomly and purified by re-streaking on Luria-Bertani agar plates. The laboratory strain B. subtilis ATCC 6633 was used as a control throughout the experiments. Isolates were identified using the API 50 CHB strips according to the manufacturer's protocols (bioMérieux) and catalase and hemolysis tests were carried out to confirm the identified isolates. Finally, the identified B. subtilis and B. coagulans were selected for further analysis. Moreover, to confirm the production of spores, B. subtilis and B. coagulans isolates were grown on Difco sporulation medium (DSM) for 24-48 h. Then, cultures were purified as described by Henriques et al [29] and stored at -80°C in Difco heart-infusion broth (HIB) with 30% glycerol for future use.
Molecular detection of spore-forming probiotics
Total genomic DNA of the isolated spore-forming probiotics was extracted using pepGOLD Bacterial DNA kit (Roche, Mannheim, Germany) according to the manufacturer’s protocol. For molecular identification of the isolated spore-forming probiotic bacteria, 16srRNA gene was investigated using the specific primers designed in this study by Primer-BLAST (Table 1). PCR assay was performed in a DNA thermal cycler (Bio-Rad, USA) in a volume of 25 μl according to the following reaction conditions: initial denaturation step at 94 °C for 5 min; 30 × denaturation at 94 °C for 30 s; annealing at 61 °C for 30 s; and extension at 72 °C for 30 s, and final extension at 72 °C for 7 min. No template control (NTC) was used as a negative control. Finally, after observing PCR products following gel electrophoresis, amplicons were sent for sequencing after purification.
Probiotic characterization of isolated bacterial strains
Resistance of vegetative B. subtilis and B. coagulans to bile salts and simulated gastric conditions was determined using the overnight LB cultures of B. subtilis and B. coagulans isolates and resuspending them in fresh LB, LB supplemented with 0.2% bile salts, or LB acidified to pH=2, and supplemented with 1 mg/mL pepsin and 1 mg/mL trypsin, respectively.
Bacterial coculture assay
Coculture of the two Bacillus spp. strains (B. subtilis and B. coagulans) with E.coli isolates harboring all the studied genes (luxS, flu, ctxM, and eae) were performed to determine any changes in expression levels of the studied virulence genes in E. coli strains. Briefly, overnight cultures of B. subtilis and B. coagulans were centrifuged and the obtained supernatant was collected and after filtering, B. subtilis and B. coagulans strains were inoculated individually in the tubes containing 5 ml of nutrient broth. Then, overnight cultures of E. coli isolates were also inoculated in each tube and once these cultures were set up, the tubes were incubated at 37 ºC under microaerophilic conditions. Each strain was also cultured alone as controls. To determine the effects of B. subtilis and B. coagulans on the expression levels of the studied virulence genes in E. coli, samples were withdrawn at the logarithmic growth phase (OD=0.08-0.1). Experiments were carried out three times independently.
RT-qPCR analysis of transcript levels of the studied virulence genes in E. coli
To investigate the expression of the studied virulence genes in E. coli after cocolture assay, real-time PCR experiment was carried out. Briefly, after at the logarithmic growth phase, 1ml of tubes was collected for RNA extraction using commercially available kits (QIAGEN RNeasy Mini kit). Samples were treated with Turbo DNase (Ambion, Grand Island, NY, USA) to eliminate any genomic DNA whose absence was confirmed using PCR and running samples on a 1% agarose gel. The quality of total RNA was assessed using the NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthetized using random hexamers (Applied Biosystems, CA, USA) and SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA), according to the recommended protocols.
Finally, quantitative real-time PCR was performed in a Rotor-Gene thermal cycler (Corbett 6000; Australia) using the SYBR Green method (AccuPower Green Star qPCR Master Mix; Bioneer; Korea). Thermal cycling consisted of an initial cycle of 95 °C for 10 min, 40 cycles of 95 °C for 12 s, 58 °C for 25 s, and 72 °C for 30 s .16s rRNA was used as the internal reference gene. After confirming the absence of primer dimers, qRT-PCR results were analyzed by 2 –(ΔΔC(t)) method [30]. A P-value less than 0.05 was considered statistically significant.
Statistical analysis
In order to evaluate the significant effect of probiotic properties of B. subtilis and B. coagulans on the expression of flu, eae, luxS, and ctxM genes in E. coli isolates, one sample T test was performed using SPSS v. 24 . A p-value<0.05 was considered as significant.