In this experimental study, 64 male Sprague-Dawley rats with an average age of eight weeks, and a mean weight of 250±20.12 g were purchased from the Animal Breeding Center of Islamic Azad University, Marvdasht Branch. After transferring the rats to the Sport Physiology Laboratory of this academic unit, for adaptation to the laboratory environment, all rats were kept for one week with free access to water and food. On the eighth day, 56 rats were injected a single dose of 8 mg/kg of trimethylethyltin (TMT) (Sigma- Aldrich, MERK Company, CAS Number: 1065-45-1) peritoneally (11). Fourteen days later rats with AD were randomly divided into 7 groups of 8 rats including 1) AD control, 2) RT, 3) 100 mg/kg RJ (RJ100), 4) 200 mg/kg RJ (RJ200), 5) RT+RJ100, 6) RT+RJ200, and 7) sham. Also in order to review the effects of TMT on serotonin and dopamine, 8 healthy rats selected as healthy control group. Before start the research protocol, for confirmation of AD induction by TMT, spiritual memory measured by Y- maze test in health control and AD control groups. Then, after confirmation of AD induction research protocol started. During 8 weeks the groups 3- 6 received daily RJ with specific doses peritoneally (12); groups 2, 5 and 6 performed RT three sessions per week with 30- 100 percentage of body weight (13) and group 7 received RJ solvent (saline) peritoneally. It should be noted that, the only difference between the control and the sham groups is that the sham group received the RJ solvent (saline); however the control group did not receive any material. RJ purchased from Jihad Daneshgahi and transferred to animal lab. RJ was kept at a temperature of 4 C throughout the period, and the daily dose was dissolved with saline and injected peritoneally (12).
RT protocol
RT protocol consisted of an eight-week climb up on a ladder (with 1 meter high, 4 cm distance between 2 steps and vertical slope). Before each training session, rats climbed on ladder, three repetitions without weight and without rest between repetitions to warm up. RTs were designed based on the weights of rats, so that in the first week, rats lifted 30 percent of their body weight in four sets of two repetitions with a rest interval of 30- 45 seconds between each repetition and a recovery interval of 1- 2 minutes between each set. This trend continued until in the eighth week, rats lifted 100 percent of their body weight (14). Indeed weights selected at the start of the training were 30% of the body weight of rats and increased by 100% of body weight in the final week (14).
Y maze test for spiritual memory evaluation
The Y maze test consists of three arms made of MDF. Each arm is 46cm long, 15cm high and 15cm wide, with equal angles to each other and the arms are connected through a central enclosure. To do this test, the rat was first placed at the end of an arm and allowed access to all areas of the maze within a 5-min interval. The number of times which the animal entered each arm was observed and recorded. The animal enters the arm when the hind legs of the animal were fully enclosed in the arm, alternating behaviors as successful and serial entry into all arms in the three overlapping sets was intended. Thus the percentage of alteration (PA) observed to maximum frequency (the total number of arms entered) was multiplied by 100.
Sampling method
Forty eight hours after the last training session and RJ injection, all rats were anesthetized with ketamine (70 mg/kg) and xylosine (3-5 mg/kg). After anesthesia, the hippocampus tissues of rats were extracted. After washing and weighing, the hippocampus tissues were transferred to cryopreserved specimens for storage and frozen at -80 ° C.
Measurement of serotonin and dopamine receptors
For molecular analysis at the gene expression level, first, extraction of RNA from the hippocampus tissue was carried out according to the manufacturer's protocol (RNA extraction kite; Yekta Tajhiz Company), then; drawing on the light absorbance property at wavelength of 260 nm, the concentration and degree of purity of the RNA sample was quantitatively obtained using the following equation:
C (µg/µl) = A260× ɛ× d/1000
After extracting RNA with high purity and high concentration from all of the samples, cDNA synthesis steps were taken according to the manufacturer's protocol (K1622; Fermantaz Company), and then the synthesized cDNA was used for reverse transcription reaction. Initially, the designed primers for genes were examined, and then genes expressions were examined by quantitative q-RT PCR method. The sequence of primers presented in Table 1.
Table 1. Primers Sequence Used in This Study
|
5’- CGTGCTTGCCATTCAGAAA -3’
|
Forward
|
B2m
|
5’-ATATACATCGGTCTCGGTGG -3’
|
Reverse
|
5’- CGGTACCTCATCGCTGCATA -3’
|
Forward
|
DRD
|
5’- AAACACTGTTGCAATGCCCC -3’
|
Reverse
|
5’- TTAGGAACTTCGTCGGCACC -3’
|
Forward
|
5-HTR
|
5’- CCATCTTGCGCTTTGCTTCA -3’
|
Reverse
|
Statistical analysis
Independent sample t- test was used for confirmation of AD induction by compare the results of Y maze test between healthy control and AD control groups. One way ANOVA and Bonferroni’s post- hoc tests were used to investigate the effects of AD and RJ solvent on the research variables. Also, two-way ANOVA was used to review the effect of RT, RJ and interaction of RT and RJ also Bonferroni’s post- hoc test was used to evaluate the difference between the doses of RJ using SPSS software (P≤0.05).