GO characterization
Commercially produced GO powder, purchased from Sigma-Aldrich (USA), was dispersed in pure water to prepare a stock solution (1 mg/mL). Prior to characterization and later experiments, the stock solution was sonicated for 2 h (40 kHz, power 99%). Prepared GO was characterized by AFM (Bruker, USA), TEM (Hitach, Japan) and Raman spectroscopy (Renishaw, UK). To acquire detailed information on its physicochemical properties, GO was dissolved in pure water, phosphate-buffered saline (PBS), and culture medium for 12 h, 24 h, 3 d, 5 d, and 7 d, and then the average diameter, zeta-potential, and PDI were analyzed by DLS (Malvern Instruments, UK).
Animal experimentation
Female C57Bl/6 mice (6–8 weeks old), purchased from the Animal Research Center of Southern Medical University (Guangzhou, China), were housed in a specific pathogen-free facility. The mice were divided into four groups (n = 5 per group): wild-type (WT) mice (WT control group), WT mice treated with GO (GO group), WT mice treated with DSS to induce colitis (DSS-WT group), and mice DSS-induced colitis that were exposed to GO (DSS-GO group). To generate the acute colitis model, female C57Bl/6 mice were administered 2.5% DSS (MP Biomedicals, USA) orally in drinking water for 5 days and then received normal drinking water for 3 days. Mice were exposed to GO separately via oral gavage at a dose of 60 mg/kg/day on second, fourth, sixth, and eighth day of the experiment. During the experiment, the mice were monitored daily to observe any occurrence of weight change, diarrhea, and rectal bleeding. A schematic representation of the animal protocol is provided in Fig. 2a.
H&E and TUNEL staining assay
The colon samples collected at the end of experiment were fixed in 4% paraformaldehyde, sectioned, and stained with H&E for examination by light microscopy. Histological scoring was carried out following a previously described system [55]. Apoptotic cells were stained with TUNEL for 1 h prior to observation under a fluorescence microscope (Nikon, Japan).
Detection of inflammatory cytokines
Total RNA from colon samples was extracted using TRIzol reagent (Gibco, USA) and quantified using the NanoDrop spectrophotometer (Thermo Fisher, USA). Quantitative real-time PCR (qPCR) was conducted and analyzed on LightCycler 480 (Roche, Switzerland). The inflammatory cytokine primers used are listed in Table 2.
Table 2
Primer sequences of IL-6, IL-10, IL-17 and IFN-γ used in the study
Gene name
|
Organism
|
Primer sequence
|
GAPDH
|
Mus musculus
|
GGGTCCCAGCTTAGGTTCAT
|
TACGGCCAAATCCGTTCACA
|
IL-6
|
Mus musculus
|
TTCACAAGTCGGAGGCTTA
|
CAAGTGCATCATCGTTGTTC
|
IL-10
|
Mus musculus
|
GGAAGAGAAACCAGGGAGA
|
CCACAGTTTTCAGGGATGA
|
IL-17
|
Mus musculus
|
TTCACTTTCAGGGTCGAGA
|
GGGGTTTCTTAGGGGTCA
|
IFN-γ
|
Mus musculus
|
ACTGGCAAAAGGATGGTG
|
GTTGCTGATGGCCTGATT
|
Cell culture
Human IEC line FHCs were purchased from ATCC and maintained in complete RPMI-1640 (Gibco, USA) culture medium. FHCs were incubated with different concentrations of GO (0, 25, and 50 µg/mL) in the presence or absence of 100 µM minocycline (MC; Selleck, USA), 400 µM N-acetyl-L-cysteine (NAC; MCE, USA), or 10 µM Compound C (Com.C; MCE, USA).
Cell viability and membrane integrity assay in vitro
The Cell Counting Kit-8 assay (Dojingdo, Japan) and lactic dehydrogenase (LDH) assay were performed to evaluate the cell viability and cell membrane integrity, respectively. FHCs were exposed to GO at different concentrations (0, 10, 25, 50, 100, and 200 µg/mL) for 24 h or incubated with 0, 25 and 50 µg/mL GO for 6, 12 and 24 h. The optical density of each well at 450 nm (for Cell Counting Kit-8 tests) or 490 nm (for LDH test) was read by a microplate reader (Molecular Devices, USA).
Confocal microscope observation of GO uptake
Using a previously described method, the prepared GO suspension was mixed with fluorescein isothiocyanate (FITC)-conjugated bovine serum albumin (BSA, Bioss Inc, China) at a mass ratio of 1:1 and incubated overnight at 37°C in the dark [56]. The mixture was centrifuged at 12000 x g for 30 min at 4°C and washed briefly with PBS. Then, the pellet was resuspended in culture medium and added to cultures of FHCs. At the end of the treatment, the cells were washed with PBS, fixed with 4% paraformaldehyde, and followed by 0.1% Triton X-100 permeabilization and nuclear staining. Finally, the samples were observed under a confocal microscope (Olympus, Japan).
TEM observations of GO uptake and mitochondrial structure
After the samples were treated as indicated, FHCs were fixed in 3% glutaraldehyde, post-fixed in osmium tetroxide, dehydrated in ethanol, and then polymerized using epoxy resin. GO uptake as well as the intracellular mitochondrial structure was observed via TEM (Hitachi, Japan).
Cell apoptosis assay
After incubation of FHCs in the presence or absence of GO for 24 h, cells were harvested and washed with PBS. After centrifugation, the cell pellet was suspended in 400 µL of Binding buffer to achieve a cell density of 1 × 106 cells/mL. The sample solution was then incubated with 5 µL Annexin V-FITC (Beyotime, China)for 15 min in the dark followed by an additional incubation with 10 µL propidium iodide (Invitrogen, USA) for 5 min. Apoptotic cells were detected by flow cytometry.
Flow Cytometry
Mitochondrial membrane potential (MMP) measurement
For MMP measurement, FHCs were treated with GO at concentrations of 0, 25, and 50 µg/mL, and cells treated with 10 µg/mL lipopolysaccharide (LPS; Sigma-Aldrich, USA) served as the positive control group. After exposure to GO or LPS, cells were incubated with JC-1 buffer mixture solution (Beyotime, China) according to the manufacturer’s instructions. Fluorescence microscopy and flow cytometry (BD Biosciences, USA) were used to measure the ratio of red/green fluorescence, which reflected the relative value of MMP.
Reactive oxygen species (ROS) generation assay
Intracellular ROS production was measured using the DCFHDA assay kit (Beyotime, China). After treatment with GO in the presence or absence of NAC and Com.C, FHCs were harvested by centrifugation and stained with DCFHDA for 30 min in the dark at room temperature. The fluorescence intensity was analyzed by fluorescence microscopy and flow cytometry.
Western blotting analysis
A total of 30 µg of protein was separated by 10% SDS-PAGE and transferred to a PVDF membrane, which was then blocked with 5% w/v BSA. Membranes were probed with the indicated primary antibodies including rabbit polyclonal antibodies against cytochrome c (Cytc), cleaved caspase-3 (c-caspase3), Bcl-2, phosphorylated (p)-AMPKα (Thr172), p-PI3K, PI3K, p-Akt, Akt, p-p53, and p53 (Cell Signaling Technology, USA) along with mouse monoclonal antibodies to Bax and AMPK (Proteintech, China) and GAPDH were used to normalize protein expression. Appropriate secondary antibodies conjugated to horseradish-peroxidase (HRP) were then added and incubated for 1 h. The antigen–antibody complex was detected using an enhanced chemiluminescence reagent (Millipore, USA). The gray intensity of the bands on the western blotting was analyzed using ImageJ software (NIH, Bethesda, USA).
Statistical analysis
The experimental data are presented as mean ± standard error of the mean (SEM). Differences among the data for the different groups were analyzed by one-way ANOVA. P-values less than 0.05 and 0.01 were considered significant, as indicated.