Targeting PDS gene to establish a transgene-free genome editing system in sorghum

doi:10.21203/rs.3.rs-3974515/v1

Download PDF

Article

Targeting PDS gene to establish a transgene-free genome editing system in sorghum

https://doi.org/10.21203/rs.3.rs-3974515/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Genome editing in plants using CRISPR/Cas9 typically involves integrating transgenic constructs into plant genome. However, a challenge arises after the target gene is successfully edited, transgene elements such as Cas9, gRNA cassette, and selective marker genes remain integrated. This integration of transgenes causes regulatory and environmental concerns, particularly for commercialization. In addressing this issue, we present the establishment of a transgene-free genome editing system in sorghum, achieved through transient gene expression without selection. We selected the phytoene desaturase (PDS) gene as the target due to its capacity to induce a visible phenotypic change, namely albinism, upon mutation. Following microprojectile co-transformation with maize optimised Cas9 vector and a gRNA cassette with kanamycin resistance gene, immature embryo (IE) derived tissues were divided into two groups (selection and non-selection) and deployed as parallel experiments. Remarkably, 4 out of 18 homozygous/biallelic editing lines in the non-selection group were identified as transgene-free lines in the T₀ generation, with no traceable transgenes. Conversely, no transgene-free editing line was achieved in the selection group. This strategy not only enables to regenerate transgene-free genome-edited lines more efficiently but also saves one generation of time by eliminating the need for self-crossing or out-crossing. Our results displayed the feasibility of achieving transgene-free genome-edited plants within a single generation in sorghum. Furthermore, this approach opens avenues for vegetatively propagated crops like pineapple, sugarcane, and banana to obtain transgene-free genome-edited lines, facilitating their commercialization.

Biological sciences/Biotechnology/Plant biotechnology

Biological sciences/Plant sciences/Plant genetics

PDS gene

albino plants

transgene-free

genome editing

transformation

sorghum

CRISPR/Cas9

transient gene expression

The clustered regularly interspaced short palindromic repeats (CRISPR) /associated nuclease Cas9 system has increasingly gained momentum and has been broadly utilized for plant genome editing worldwide in the last decade¹. Genome editing by CRISPR/Cas9 has been extensively investigated for gene function, plant breeding, and crop improvement². The CRISPR/Cas9 system has displayed tremendous advantages over traditional methods in how to generate mutations in a precise and predictable way³. The process of genome editing is typically based on genetic transformation, which means two essential components of the Cas9, and gRNA cassettes have been stably integrated into plant chromosome. However, when the target gene is completely edited by CRISPR/Cas9, all transgenic elements, such as the Cas9 gene, selective marker gene, and gRNA(s), are no longer needed in plants. On the sharp contrary, those components could cause off-target genome editing due to constitutive gene expression.

While CRISPR/Cas9 technologies offer precise genome-editing capabilities, alleviating concerns about producing genetically modified organisms (GMOs), global regulatory systems for categorizing CRISPR-edited crops as GMOs vary considerably^{4, 5}. In Australia, the Office of the Gene Technology Regulator (OGTR) oversees GMO regulation². Notably, not all genetically edited (GE) foods are classified as GMOs in Australia, allowing their cultivation without regulatory restrictions or labelling⁶. The Gene Technology Act 2000 (https://www.legislation.gov.au/C2004A00762/latest/text) currently governs these regulations. Considering different DNA double-strand break modifications, genome-modified products can be classified into four groups: (1) oligonucleotide-mediated genome modification (ODM), and the remaining three groups fall under site-directed nuclease technologies (SDN), including ZFN, TALEN, and CRISPR/Cas: (2) SDN1, or Site-directed mutagenesis pathway 1 without a template; (3) SDN2, Site-directed mutagenesis pathway 2 with a homologous template, causing modifications in a few bases; (4) SDN3, Site-directed mutagenesis pathway 3 with a homologous template with ends. Australia classifies crops produced using SDN1 as conventional crops, but those generated using ODM, SDN2, and SDN3 are considered GMOs⁵. In Japan, SDN1 and SDN2 are treated as non-GMO. In the USA, the regulatory frame for GMOs is implemented through three federal agencies: United States Department of Agriculture (USDA), Environmental Protection Agency (EPA), and Food and Drug Administration (FDA). the FDA, USDA, Animal and Plant Health Inspection Service (APHIS), and EPA jointly regulate CRISPR-based agricultural products. Transgene-free CRISPR-edited plants are exempt from conventional GMO regulations imposed by the FDA. According to USDA, ODM, SDN1, and SDN2 plants are deregulated, aligning with conventional breeding practices⁶. However, SDN3-created plants are evaluated case-by-case for regulatory categorization⁵.

Numerous strategies have been explored to generate transgene-free genome-edited plants, primarily categorized into three approaches: DNA-free gene editing methods, transient expression of plasmid-based CRISPR-DNA, or stable integration with self-crossing or subsequent backcrossing. DNA-free gene editing techniques, including ribonucleoprotein (RNP), virus-induced gene editing, have gained prominence in crop genome editing⁷. Among these, preassembled CRISPR/Cas ribonucleoproteins (RNPs) represent a direct and efficient approach for DNA-free genome editing⁸. The application of pre-assembled CRISPR/Cas9 RNPs was pioneered in 2005, initially demonstrated in Arabidopsis thaliana, tobacco, lettuce, and rice protoplasts, and subsequently adopted in various plant species^{4, 5}. While the use of RNPs is prevalent, it presents challenges, particularly in economically vital crops with complex tissue culture systems. Protoplast-based methods, essential for many crops, pose challenges in recalcitrant crops like sorghum⁹. Efforts have been made to explore alternatives such as zygotes and immature embryos, although these alternatives remain limited to specific plant species^{7, 8}. To eliminate transgenes post gene editing, methods like self-pollination and out-crossing have been employed⁴. In self-pollinated crops, transgene-free lines can be identified through rigorous PCR screening and sequencing from T₁ progeny. However, these PCR-based methods are time-consuming and labour-intensive when identifying transgene-free plants from a pool of transgenic plants. To enhance efficiency, various markers such as fluorescent markers, pigments, chemicals, enzymatic reactions, and suicide genes are utilized⁷.

This study focuses on achieving transgene-free genome-edited sorghum plants in a single generation through biolistic bombardment. The characterization of these transgene-free CRISPR-edited sorghum plants involves PCR, sequencing, and transcriptomics analyses. The elimination of transgenes holds significant potential for the commercialization of sorghum lines subject to genome editing.

2.1. Observation of sorghum albino plantlets from tissue culture

In total 72 plates (seven IE-derived calluses per plate) were bombarded using a particle inflow gun (PIG), 18 plates were sub-cultured onto selection-free regeneration media (RM) whilst 54 plates were sub-cultured onto selective regeneration media (SRM). The albino plantlets were observed as early as in two weeks post bombardment in both selection and non-selection groups and were easy to be distinguished from surrounding plantlets (Fig. 1a, and 1d). During three subcultures in nine weeks after transformation, any viable albino plantlet from both the SRM and RM groups were separated and transferred to RM (Fig. 1b, and 1e). Cheremic albino shoots were also observed from two groups (Fig. 1c, and 1f). During the final subculture, in the SRM group, 16 “albinos” were found in 146 plantlets which demonstrates an editing efficiency of 10.9%. Whilst in the RM group, 18 “albinos” were produced across 8366 plantlets, representing an editing efficiency of approximately 0.2%. However, when comparing the number of albinos directly to the initial material or the number of embryogenic calluses, editing efficiencies of 14.3% and 4.2% were observed in the RM group and SRM group, respectively.

2.2. PCR screening of PDS gene and CRISPR plasmids

The genomic DNA extraction underwent rigorous validation for both concentration and quality, utilizing Nanodrop and electrophoresis tests. Gel images, presented in Fig. 2a and 2b, focusing on the PDS gene, exhibited variations in the sizes of PCR amplicons among different albino samples. This implies the presence of large fragment deletions in specific albino plants, while certain samples displayed double bands, indicating potential biallelic edits.

Figure 2c provides a comprehensive overview of the percentage distribution of different editing events within the SRM, RM, and overall editing pathways. With the support of Sanger sequence data in subsequent analyses, we categorized occurring editing events into five major groups: (1) large deletions, (2) large deletions accompanied by unidentified insertions, (3) complex rearrangements, (4) alterations involving several nucleotides, and (5) one albino plant where no modification was discerned within the target PCR region compared to the wild-type Tx430. In this albino plant, the editing could occur outside the PCR region. Or the albino was caused by unknown reason.

Among editing pathways with selections SRM group, large fragment deletion emerged as the most frequent event, accounting for 50%, followed by complex rearrangements (25%), large deletions with random insertions (18.8%), and alterations involving several nucleotides (6.2%). Intriguingly, in the absence of selection, a notable shift in the majority of editing events was observed from large deletion to complex rearrangements (Fig. 2c).

Within the RM group, half of the "albino" plants exhibited complex rearrangements, followed by 38.9% with large fragment deletions, 5.6% with alterations involving several nucleotides, and 5.6% (Fig. 2c) showing no change in sequence compared to the wild-type Tx430. Combining the two pathways, large fragment deletion and complex rearrangement emerged as the two most frequent editing events among the 34 albino plants, accounting for 44.1% and 38.2% (Fig. 2c), respectively. Less frequent editing events included large deletion with random insertion (8.8%), alterations involving several nucleotides (5.9%), and no change (2.9%). These findings provide a comprehensive insight into the diverse editing events observed in the albino plants obtained through different editing pathways.

To analyse the transgenic status of 34 albino plants from SRM and RM groups, we designed PCR primers to target six distinct regions in two plasmids (3 regions per plasmid), as illustrated in Fig. 3a and 3b. PCR analyses mainly focused on the amplification of Cas9 and NPTII regions among 16 samples from SRM group and 18 samples from RM group, as displayed in Fig. 3c-3f. All PCR results on six distinct regions are recorded in the Table 1. For the remaining four regions from the SRM group, gel images are included in the supplementary file (Fig. S1).

Addressing the presence of zCas9 and the selective marker (NPTII), a significant trend emerged among the majority of albino plants, indicating zCas9 positivity. Noteworthy differences in the incidence of NPTII bands were observed between SRM and RM groups (Fig. 3d and 3f). In the SRM group, there was a higher prevalence of NPTII bands compared to the RM group. This intriguing observation underscores the potential of the selection-free system could promote transgene-free events in RM group. The higher presence of NPTII bands in the SRM group, as highlighted in Fig. 3, specifically underlines the importance of selection to achieve higher genetic transformation in SRM group.

The PCR results through the utilization of six primer pairs targeting the zCas9 and NPTII plasmids and extending the 34 albino plants, have been systematically summarized in the Table 1. Within the SRM group, all 16 albino plants were conclusively confirmed to be transgenic because of positive PCR bands. It is notable that six PCR regions from two plasmid are fully integrated into 9 albino plants, accounting for 56% in the SRM group (Table 1). However, it is noteworthy that plants SPDS-5 and SPDS-10 lacked the integration of the NPTII plasmid in their genomes.

In the absence of selection, the integration of both plasmids is much less than in the presence of selection. Four albino plants PDS-1, PDS-9, PDS-11, and PDS-13 were identified as transgene-free genome editing plants, without any integration of six regions from both plasmids, representing 22.2% of the analysed RM samples (Table 1). This observation emphasizes the occurrence of non-GM events in the RM group. Interestingly, among 18 albino plants, only sample PDS-14 exhibited the presence of sequences from both plasmids, constituting of 5.6% of 18 samples. The remaining albino plants are lacking integration at least one targeted region of the plasmids in their genomes, underscoring the variability in the editing outcomes of SR group.

This detailed breakdown of the PCR results not only confirms the successful transgenic status within the SRM group but also sheds light on specific instances of non-GM events in RM group, thereby providing a more comprehensive understanding of the genetic modifications. These findings contribute significantly to our assessment of the precision and efficacy of the applied genetic modification techniques, highlighting the need for scrutiny of individual plants to discern the intricacies of transgene integration.

Table 1

PCR results of 6 pairs of primers to verify the existence of zCas9 plasmid and NPTII plasmid. If there was no plasmid fragment left, it is regarded as a non-transgenic plant.
Group	No.	zCas9 plasmid			NPTII plasmid			Transgene-free
Group	No.	Cas9	Ubi	Ori	NPTII	Amp	gRNA	Transgene-free
Selective group (SRM)	SPDS-1	+	+	+	+	+	-	No
	SPDS-2	+	+	+	+	+	-	No
	SPDS-3	+	+	+	+	+	+	No
	SPDS-4	+	+	+	+	+	+	No
	SPDS-5	+	+	+	-	-	-	No
	SPDS-6	+	+	+	+	+	+	No
	SPDS-7	+	+	+	+	-	+	No
	SPDS-8	+	+	+	+	+	+	No
	SPDS-9	+	+	+	+	+	+	No
	SPDS-10	+	+	+	-	-	-	No
	SPDS-11	+	+	+	+	+	+	No
	SPDS-12	+	+	+	+	+	+	No
	SPDS-13	+	+	+	+	+	+	No
	SPDS-14	-	+	+	+	+	+	No
	SPDS-15	+	+	+	+	-	+	No
	SPDS-16	+	+	+	+	+	+	No
Selection-free group (RM)	PDS-1	-	-	-	-	-	-	Yes
	PDS-2	+	-	-	-	-	-	No
	PDS-3	+	+	+	-	-	-	No
	PDS-4	+	+	+	-	-	-	No
	PDS-5	+	+	+	-	+	+	No
	PDS-6	+	-	-	-	-	-	No
	PDS-7	+	-	-	-	-	-	No
	PDS-8	+	-	-	-	-	-	No
	PDS-9	-	-	-	-	-	-	Yes
	PDS-10	+	-	+	-	-	-	No
	PDS-11	-	-	-	-	-	-	Yes
	PDS-12	+	-	-	-	-	-	No
	PDS-13	-	-	-	-	-	-	Yes
	PDS-14	+	+	+	+	+	+	No
	PDS-15	+	+	+	-	-	-	No
	PDS-16	+	-	-	-	-	-	No
	PDS-17	+	+	+	-	-	-	No
	PDS-18	+	-	-	-	-	-	No

2.3. Sanger sequencing of the albino plantlets

Across 34 albino plants, the sequence of editing events was unfolded, exclusively within the gRNA target regions situated downstream of the Protospacer Adjacent Motif (PAM) site. The Sanger sequence blast results unveiled five distinct editing outcomes, as previously described. A comprehensive summary detailing the frequency of each of these editing events is provided in Fig. 2c. Sanger sequencing data of PCR on one wild type Tx430 and 34 albino plants are included in the supplementary S2 with GenBank access number.

To further illuminate these findings, Fig. 4 illustrates the sequences of selected samples representing four different types of meaningful editing events in comparison with the wild-type Tx430.

In our comprehensive analysis, the predominant types of editing events were characterized by substantial fragment deletions and complex rearrangements, both orchestrated by dual guide RNAs (gRNAs), as depicted in Fig. 4a and 4c. Notably, the incidence of one or two nucleotide changes exhibited a lower frequency (Fig. 4d). While indels of a few hundred nucleotides have been observed in prior experiments using Cas9 or other nucleases, it is pertinent to highlight that the most frequent editing events typically involve indels of less than 20 base pairs. Consequently, the observed occurrence of large deletions within the edited plant population in this study is postulated to be a consequence of employing two distinct gRNAs in the CRISPR/Cas9 process.

2.4. RNA extraction and RT-PCR results

The Ubi-1 promoter is designed to drive Cas9 gene expression. To demonstrate that promoter and target gene are prerequisite to gene expression, from distinct gel patterns in Table 1, six albino samples were meticulously selected for analysis, including SPDS-3 and PDS-17 that exhibited both Cas9 gene and Ubi-1 promoter fragments, PDS-2 and PDS-16 that showed only Cas9 gene without Ubi-1 promoter fragment, PDS-1 and PDS-13 that were devoid of both Cas9 gene and Ubi-1 promoter. The absence of the Ubi-1 promoter theoretically implies a lack of Cas9 protein expression. We conducted RT-PCR to assess Cas9 protein expression post-transcription. The successful Cas9 expression is only detected in the selected two albino samples (SPDS-3 and PDS-17) which contained both Ubi-1 promoter and Cas9 gene in the gel image (Fig. 5), reinforcing the importance of the relationship between promoter and gene. This meticulous analysis offers valuable insights into the functionality of the Ubi-1 promoter in facilitating Cas9 protein expression.

It is noteworthy that if the Cas9 DNA is in a "free" state in the cell and not integrated into the chromosome, transient expression still occurs. However, if only the cas9 gene is integrated into the genome without the Ubi-1 promoter, the cas9 gene wouldn't be stably and continuously expressed in transgenic plants. In the RM group, aside from four transgene-free albino plants, 14 Cas9 stably transformed albino plants were considered transgenic, indicating the presence of the exogenous cas9 gene. Interestingly, more than half of these transgenic plants wouldn't further express Cas9 due to the absence of the Ubi-1 promoter. The brightness of the bands further underscores successful Cas9 expression detection in the samples compared to the 1kb ladder, indicating high-quality total RNA extraction (Fig. 5), as supported by Nanodrop measurements.

Through biolistic transformation, we achieved editing efficiencies of 14.3% (18 albinos out of 126 transformed IEs) and 4.2% (16 albinos out of 378 transformed IEs) in the RM group and SRM group, respectively. This outcome highlights that the absence of selection is advantageous for genome editing, attributed to the dominant transient gene expression observed in the early stages post-transformation. Conversely, transformation efficiencies of 0.79% (1 containing NPTII out of 126 transformed IEs) and 3.7% (14 containing NPTII out of 378 transformed IEs) were achieved in the RM group and SRM group, respectively. These findings underscore the importance of selection in the transformation process, as it imposes a beneficial selection pressure for genetic transformation.

The efficiency of genome editing is widely acknowledged to be intricately linked to the sequence of guide RNA (gRNA) and its secondary structure. For optimal results, careful consideration should be given when designing gRNA sequences. Specifically, the GC content of the gRNA is a critical factor, with an optimal range falling between 30% and 80%. Notably, a GC content within the narrower range of 40–60%, coupled with purine residues in the last four nucleotides of the gRNA, appears to significantly enhance editing efficiency. Recent findings highlight that the presence of a cytosine directly following the Protospacer Adjacent Motif (PAM) sequence is unfavourable for genome editing¹⁰. For scientists who favour pre-designed, user-friendly, and free-of-charge gRNA design resources like CRISPOR, the platform offers relevant scores to guide users in selecting the most suitable parameters for their specific assays or model organisms. For example (1) The Fusi/Doench score is particularly recommended for guiding the U6 promoter plasmid. (2) The MIT score, representing guide specificity on a scale of 0–100 (100 = best), aids in predicting all potential off-targets associated with a guide. (3) The CFD specificity score, akin to the MIT specificity score, offers enhanced accuracy. Notably, the CFD specificity score shows a better correlation with the total off-target cleavage fraction. In essence, higher specificity scores are generally indicative of fewer off-target sites and lower frequencies of off-target modifications. This holds significant importance since the Cas9 binding specificity to the target DNA depends on both gRNA–DNA base pairing and the presence of the Protospacer Adjacent Motif (PAM) sequence (NGG) immediately downstream of the target region. In this study, we employed a gRNA chosen for its high scores on CRISPOR to verify its reliability in sorghum.

There are several points related to the application of CRISPR/Cas9 system in plants that could be taken into consideration: (1) the target region or gene; (2) the type of Cas9 protein and its corresponding PAM sequence; (3) the promoters used in the vector to drive the gRNA or the Cas9; and (4) the additional constraints based on cloning strategy. The selection to integrate the gRNAs into the NPTII plasmid rather than the zCas9 plasmid was dependent on the comparatively small plasmid size. The selected maize-codon optimized Cas9 plasmid has higher GC-rich codons for the experiment and was already optimized for cereal crops, such as maize because the sorghum genome is closely related to the maize genome. The maize ubiquitin (ZmUbi-1 or Ubi-1) gene was used to drive the Cas9 and the NPTII gene expression. Two different sorghum U6 promoters that have been developed were chosen to drive the expression of the gRNAs ¹¹ In our study, 97% of albinos (33 in 34) were edited by both CRISPR guides, which indicates the designed gRNAs by the online software CRISPOR showed high efficiency. Additionally, the endogenous U6 promoters from sorghum were both effective in expressing the gRNAs which is in correspondence with other studies demonstrating the effectiveness of endogenous U6 promoters in their respective grains^{12, 13}.

Although 25% of transformed IEs were subcultured onto RM without the antibiotic selection and the rest were subcultured onto SRM with selection, there were more albino plants regenerated from RM than SRM. The previous study demonstrated that transient gene expression generally lasts around ten days post-bombardment ¹⁴. The selection-free system also indicates that it is feasible to observe the homozygous edited albino plants, but it is hard to detect all potential heterozygous plants due to a large number of regenerated plantlets. Though most of the albino plants are integrated with Cas9 fragments, our results displayed that two-thirds of albinos did not have full Cas9 plasmid insertion in the non-selection group. Unlike the Cas9 gene, the majority of albino plants did not contain NPTII gene, which means that genome editing was caused by the transient gene expression. This result indicates the selective gene transient expression was dominant at the early stage. Transient gene expression is often used to study the effects of short-term expression on eukaryotic cells and to optimize the transformation system for stable gene expression, meanwhile, it is also beneficial to use the transient expression for optimizing promoters¹⁵. Furthermore, 33 albinos were confirmed to be edited based on Sanger sequencing. One albino plant was not clearly identified as what caused it, and this may be a mutant outside of the PCR region. It is rarely observed albino mutation arising with the low frequency via somaclonal variation in the genotype Tx430 in our tissue culture system. The edited types were varied under two gRNAs. The paramount outcome is that four transgene-free CRISPR/Cas9 edited events were generated among 18 albino plants from RM group, which indicates the success of this new strategy.

Future work could focus on how to optimize this transgene-free system in sorghum, the PDS gene will be continuously used as the target gene to explore how to combine the antibiotics selection system and transient expression, which can make the considerable editing events more efficient and less laborious. Aside from the PDS gene, it will also help to target other functional genes that cannot easily be distinguished by the phenotypes. Additionally, once this system is established, it can be applied to more plant species and will expedite the CRISPR/Cas9 edited crops to be traded on the market, meanwhile, realizing more economic value and providing the bridge from the lab to the public.

YZ and GL who performed the experiments on plant materials declare the experiment complied with relevant institutional, national, and international guidelines and legislation.

4.1. Plant materials

The wild-type Sorghum bicolor Tx430 line was cultivated in the glasshouse at the University of Queensland using potting mix, with a controlled temperature maintained at approximately 27–28°C during the day and 20–22°C night temperatures. Despite the glasshouses being temperature-controlled, the sorghum plants exhibit optimal health during the summer months, yielding the most suitable explants for tissue culturing due to the elevated levels of sunlight. Regular applications of fertilizers were administered to the soil, and pest and disease surveillance was conducted weekly.

4.2. Plasmids for genome editing

Two plasmids were used for sorghum transformation. pBUN411-zCas9 (Fig. 6a) harbours the maize code-optimized Cas9 gene and is designed for effective use in maize Agrobacterium-mediated transformation¹⁶. The NPTII-SbPDS vector (Fig. 6b), synthesized by Gene Universal (USA), includes two gRNAs designed to target the sorghum PDS sequence, adapted from Massel, Lam, Hintzsche, Lester, Botella and Godwin ¹¹. Additionally, the vector contains the neomycin phosphotransferase gene (NPTII), providing resistance to a range of aminoglycoside antibiotics, including kanamycin and G418.

4.3. CRISPR gRNAs design of sorghum PDS gene.

The gRNAs design for the sorghum phytoene desaturase (PDS) gene (Sobic.006G232600, Alias: Sb06g030030) was performed using the online software CRISPOR (crispor.tefor.net) and CRISPR-P 2.0^{17, 18}. The optimal gRNAs for PDS gene were selected according to the guidelines. For the gRNAs, G was added to the 5' end of gRNA to improve U6 mediated transcription¹⁹.

4.4. Sorghum tissue culture and transformation

The procedures of sorghum tissue culture and transformation were described as Liu, Campbell and Godwin ²⁰. Briefly, immature embryos (IE) were isolated for inducting embryogenic callus. The zCas9 plasmid and the NPTII plasmid with gRNAs were co-transformed into callus nine to 11 days post-initiation. The transformed IE-derived calluses were rest on regeneration medium for three days after bombardment. Then calluses were divided into two groups: the first group was with antibiotic selection Geneticin (G418 30 mg/L in callus regeneration medium) and the second group was without selection in the regeneration medium. Callus regeneration and genome editing efficiency were assessed under different conditions, such as with /without selection, under light /in dark, and different duration of the selection.

4.5. Albino observation

In the group with antibiotic selection (geneticin G418), albino phenotypes were observed as early as two weeks post bombardment. By comparison, within the non-selection group, the emergence of albino phenotypes was noted approximately three weeks post bombardment. Upon discerning the presence of albino individuals, they were separated and further sub-cultured onto a fresh regeneration plate without selection.

4.6. PCR primers design

Multiple regions of each plasmid, including the primary gene cas9 and NPTII, promoter (maize ubiquitin primer), and vector backbone (ampicillin-resistant gene and the Ori region), were targeted for PCR screening. All primers were designed by the online software Primer3 ²¹ (Table 2).

Table 2

Primers targeting different regions in two plasmids
Name	Sequence	Size (bp)	Target Plasmid/Gene	Annealing temperature
AmpF	CTGGCGTAATAGCGAAGAGG	746	NPTII	65.5 ℃
AmpR	ATAATACCGCGCCACATAGC	746	NPTII	65.5 ℃
KanF	AGACAATCGGCTGCTCTGAT	740	NPTII	65.5 ℃
KanR	TCATTTCGAACCCCAGAGTC	740	NPTII	65.5 ℃
gRNAF	GGGCGACGTTGTTTAGTACC	879	NPTII	64 ℃
gRNAR	GCACTTCAAACAAGTGTGACAA	879	NPTII	64 ℃
cPDSF	GGGCAGCTCTCTTCGTTTTT	477	PDS gene	60 ℃
cPDSR	TGAAGAGAACCTTGAGGACCA	477	PDS gene	60 ℃
cPDSF2	ACACTGGCTGCCTCTCATCT	910	PDS gene	60 ℃
cPDSR2	GTGTGATGGTGTGCCTCAAC	910	PDS gene	60 ℃
UbiF	GGGCCCGGTAGTTCTACTTC	875	zCas9	63.5 ℃
UbiR	CGTATGAAGGCAGGGCTAAA	875	zCas9	63.5 ℃
zCas9F	ACGGTTAAGCAGCTCAAGGA	900	zCas9	60 ℃
zCas9R	CCTGGTGAGGACCTTGTTGT	900	zCas9	60 ℃
OriF	CTGGCAGTTCCCTACTCTCG	1105	zCas9	67 ℃
OriR	GCCTACATACCTCGCTCTGC	1105	zCas9	67 ℃

4.7. DNA extraction of primary albinos

Once the albinos grew multiple shoots, the genome DNA was extracted from young leaves with the ISOLATE II Plant DNA kit (Bioline, UK). The DNA concentration and quality were verified using a Thermo Scientific™ NanoDrop™ One (Thermo Fisher Scientific Inc., USA) to have an A260/A280 absorbance ratio higher than 1.80. To check genome DNA quality, 5µl extracted DNA was loaded on a 1% agarose-TAE gel with SYBR safe (Invitrogen, USA) and the gel was performed at 90V for 50 minutes with the 1kb + DNA ladder (New England Biolabs, UK) was used as a size indicator. Then the Gel Doc + Gel Documentation System (BIO-RAD, USA) was utilized to visualize and document the gel image to observe the existence and size of the target product. Then the PDS PCR products were cleaned up using ExoI and rSAP PCR Product Clean-up Reagent (New England Biolabs, UK) with the provided protocol and then sent to the Australian Genome Research Facility (AGRF) for Sanger sequencing using either the PDS gene forward or reverse primer.

4.8. RNA extraction and Reverse transcriptase PCR (RT-PCR)

To confirm the Cas9 gene expression in some albino lines, the plant total RNA was extracted from leaves using the ISOLATE II RNA Plant Kit (Bioline, UK). Around 100mg of fresh leaves from each sample were weighed and then ground in liquid nitrogen using a mortar and pestle. After grinding into fine powder, they were transferred into a new 1.5ml tube and then the lysis buffer RLY was added immediately. The following steps were conducted under the manufacturer's protocol. The extracted RNA concentration and quality were verified using a Thermo Scientific™ NanoDrop™ One (Thermo Fisher Scientific Inc., USA) to have an A260/A280 absorbance ratio of around 2.1 and gel electrophoresis showed clear 18S and 28S bands.

After verifying the quality of RNA, the GoScript™ Reverse Transcription System kit (Promega, USA) was used to synthesize the first-strand cDNA according to the manufacturer’s instructions. For incubation of RNA and primer, 1µg total RNA and 0.5µg Oligo (dT)15 was used. Then 3.75mM MgCl₂ were used to prepare the RT reaction mix. Then the synthesized first-strand cDNA was used to do the PCR with the zCas9 primers and 2µl cDNA was used in each PCR reaction. Then, 1% agarose-TAE gel with SYBR safe (Invitrogen, USA) was made and the gel was run at 90V for 50 minutes.

Conflicts of interest

The authors declare no conflicts of interest.

Author Contribution

Y.Z., M.C., and G.L. wrote the main manuscript text and prepared all figures. Y.Z., K.M., I.G., and G.L. discussed the conception of the project. Y.Z., and G.L. carried out experiments. All authors reviewed the manuscript."

Acknowledgement

We would like to thank GRDC (Grains Research & Development Corporation) for funding the GRDC Better Sorghum with Larger Grain project (2018-2022).

Data Availability

Data is provided within the manuscript and supplementary information files.

Kim, J.I. & Kim, J.Y. New era of precision plant breeding using genome editing. Plant Biotechnology Reports 13, 419–421 (2019).
Zhang, Y., Restall, J., Crisp, P., Godwin, I. & Liu, G. Current status and prospects of plant genome editing in Australia. In Vitro Cellular & Developmental Biology - Plant (2021).
Kumar, K. et al. Genetically modified crops: current status and future prospects. Planta 251, 27 (2020).
Gupta, S., Kumar, A., Patel, R. & Kumar, V. Genetically modified crop regulations: scope and opportunity using the CRISPR-Cas9 genome editing approach. Mol. Biol. Rep. 48, 4851–4863 (2021).
Ahmad, A., Ghouri, M.Z., Munawar, N., Ismail, M., Ashraf, S. & Aftab, S.O. in CRISPR Crops 261–287 (2021).
Wolt, J.D., Wang, K. & Yang, B. The Regulatory Status of Genome-edited Crops. Plant Biotechnol J 14, 510–518 (2016).
He, Y.B., Mudgett, M. & Zhao, Y.D. Advances in gene editing without residual transgenes in plants. Plant Physiology 188, 1757–1768 (2022).
Zhang, Y. et al. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA. Nature Communications 7 (2016).
Sairam, R.V., Seetharama, N., Devi, P.S., Verma, A., Murthy, U.R. & Potrykus, I. Culture and regeneration of mesophyll-derived protoplasts of sorghum [(L.) Moench]. Plant Cell Rep. 18, 972–977 (1999).
Bruegmann, T., Deecke, K. & Fladung, M. Evaluating the Efficiency of gRNAs in CRISPR/Cas9 Mediated Genome Editing in Poplars. International journal of molecular sciences 20, 3623 (2019).
Massel, K., Lam, Y., Hintzsche, J., Lester, N., Botella, J.R. & Godwin, I.D. Endogenous U6 promoters improve CRISPR/Cas9 editing efficiencies in Sorghum bicolor and show potential for applications in other cereals. Plant Cell Rep. 41, 489–492 (2022).
Ng, H. & Dean, N. Dramatic improvement of CRISPR/Cas9 editing in Candida albicans by increased single guide RNA expression. mSphere 2 (2017).
Ma, X. et al. A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular plant 8, 1274–1284 (2015).
Liu, G. & Godwin, I.D. Highly efficient sorghum transformation. Plant cell reports 31, 999–1007 (2012).
Able, J.A., Rathus, C. & Godwin, I.D. The investigation of optimal bombardment parameters for transient and stable transgene expression in sorghum. In Vitro Cellular & Developmental Biology-Plant 37, 341–348 (2001).
Xing, H.L. et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 14, 12 (2014).
Haeussler, M. et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome biology 17, 148 (2016).
Liu, H., Ding, Y., Zhou, Y., Jin, W., Xie, K. & Chen, L.-L. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Molecular Plant 10, 530–532 (2017).
Lone, B.A., Karna, S.K.L., Ahmad, F., Shahi, N. & Pokharel, Y.R. CRISPR/Cas9 System: A Bacterial Tailor for Genomic Engineering. Genetics research international 2018 (2018).
Liu, G.Q., Campbell, B.C. & Godwin, I.D. in Cereal Genomics: Methods and Protocols, Vol. 1099. (eds. R.J. Henry & A. Furtado) 219–234 (2014).
Untergasser, A. et al. Primer3-new capabilities and interfaces. Nucleic Acids Res. 40, 12 (2012).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Targeting PDS gene to establish a transgene-free genome editing system in sorghum

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

2.1. Observation of sorghum albino plantlets from tissue culture

2.2. PCR screening of PDS gene and CRISPR plasmids

2.3. Sanger sequencing of the albino plantlets

2.4. RNA extraction and RT-PCR results

3. Discussion

4. Materials and methods

4.1. Plant materials

4.2. Plasmids for genome editing

4.3. CRISPR gRNAs design of sorghum PDS gene.

4.4. Sorghum tissue culture and transformation

4.5. Albino observation

4.6. PCR primers design

4.7. DNA extraction of primary albinos

4.8. RNA extraction and Reverse transcriptase PCR (RT-PCR)

Declarations

Conflicts of interest

Author Contribution

Acknowledgement

Data Availability

References

Additional Declarations

Supplementary Files

Status:

Version 1