Susceptibility to South African cassava mosaic virus is Associated with a RING Finger E3 Ubiquitin Ligase

doi:10.21203/rs.3.rs-41420/v1

Download PDF

Research

Susceptibility to South African cassava mosaic virus is Associated with a RING Finger E3 Ubiquitin Ligase

https://doi.org/10.21203/rs.3.rs-41420/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Nov, 2020

Read the published version in Virology Journal →

You are reading this older preprint version

Read the latest preprint version →

Background

The ubiquitylation of proteins is reprogrammed by plant geminiviruses which alter the ubiquitin proteasome system (UPS) to fully infect the host. A RING Finger E3 Ubiquitin Ligase (MeE3L) is located on a major cassava mosaic disease resistance-associated quantitative trait locus. Here, we examine the genetic structure and relative expression of MeE3L (native and gene-edited mutant), and determine how MeE3L affects geminivirus South African cassava mosaic virus (SACMV) DNA accumulation.

Methods

Cassava protoplasts of model, susceptible and tolerant genotypes were transformed with SACMV infectious clones and/or a CRISPR-editing construct targeting the MeE3L using PEG4000-mediated transfection. DNA and RNA were extracted from transformed protoplasts at 24 hours post-transfection. Relative SACMV load quantitation was determined using DpnI-digested total DNA via qPCR and MeE3L relative expression was determined via reverse transcriptase qPCR, and results were analysed using the 2^-ΔΔ method. The MeE3L exonic region was sequenced on the ABI 3500XL Genetic Analyzer platform; and sequences were analysed for mutations and for construction of a phylogenetic tree using the Maximum Likelihood method and Tamura-Nei model.

Results

Results show that SACMV DNA accumulation is cassava genotype-dependent. The study also reveals that native and mutant MeE3L is differentially expressed during SACMV infection in protoplasts of susceptible and tolerant cassava landraces. The susceptible cassava landrace encodes a RINGless MeE3L and the MeE3L base sequence is a determinant of cassava’s response to SACMV. Results further show that SACMV silences the MeE3L RING domain in the susceptible and tolerant landraces; and specifically targets the tolerant MeE3L gene homolog for silencing.

Conclusions

These findings suggest that MeE3L is a target of SACMV, contributing to susceptibility in cassava. The MeE3L base sequence is a determinant of cassava’s response to SACMV. The MeE3L RING domain is actively silenced by SACMV and therefore may be essential for host defence against geminiviruses. The study provides further evidence, in addition to existing literature, that plant E3 ligases are exploited by geminiviruses to enhance pathogenicity.

Stem Cell & Developmental Cell Biology

Cassava mosaic disease

geminivirus

ubiquitin E3 ligase

ubiquitylation

The ubiquitin proteasome system (UPS) plays contrasting roles in plant immunity during viral infection. This post-translational modification system may boost innate immunity or enhance viral activity (Verchot, 2016). The UPS is an enzymatic cascade in which the E1 ubiquitin-activating enzyme presents an ubiquitin molecule to the E2 ubiquitin-conjugating enzyme which complexes with the E3 ubiquitin ligase for transfer of the ubiquitin molecule to the proteins destined for degradation, or to another ubiquitin molecule (Komander, 2009). The E3 ligase recognises and binds to the substrate before covalently ligating at least one ubiquitin to the substrate (Pickart, 2001). Plant E3 ligases are subdivided into 11 classes: the RING (Really Interesting New Gene), the CRL (Cullin RING), the RBR (RING-between-RING RING), the HECT (Homologous to E6-associated protein C-terminus) (Morreale and Walden, 2016), the U-Box (Hatakeyama et al., 2001), the F-box (Lee et al., 2016), the ASK (Arabidopsis SKP1-related), the BTB (bric a brac, tramtrack and broad complex), the APC (anaphase-promoting complex), the CUL4-DDB (cullin4-damaged DNA-binding protein) and the cyclin F (CCNF) proteins (Craig et al., 2009). E3 ligases can function independently as a single component or as part of modular multi-subunit complexes containing a RING module (e.g. RBX1), an assembly platform module (e.g. APC2) or a substrate recognition module (e.g. DDB1) (Haglund, 2005).

RING E3 ligases function in innate and adaptive immunity to restrict viruses and can be responsible for particular regulation of specific substrate proteins based on their ability to act as a molecular bridge between the substrate and the ubiquitin-carrying E2 enzyme (Barry and Früh, 2006). Plant and animal viruses may encode RING E3 ligases which ubiquitinate host proteins to downregulate host immune responses or they may hijack host RING E3 ligases to prevent ubiquitination of viral proteins and promote viral replication (Zhang et al., 2018). Some viruses encode RING proteins that mediate degradation of undesirable host proteins. It has been suggested, based on experimental evidence, that some viral factors recruit viral F-box proteins which usurp the function of host F-box proteins and direct E3 ligase complexes from the immune response to phytohormone signalling, or to interfere with the RNA silencing process by targeting Argonaute proteins for degradation (Verchot, 2016). Some R proteins recognise specific viral domains and relay them to E3 ligase complexes and the 26S proteasome for degradation (Liu et al., 2002), hence blocking needless activation of defense signalling (Duplan and Rivas, 2014) by controlling their accumulation (Gou et al., 2012). Degradation of viral movement proteins by the plant UPS directly diminishes viral mobility and thus, infection (Shen et al., 2016). Viral-encoded DUBs may reverse ubiquitination processes to improve viral replication (Alcaide-Loridan and Jupin, 2012). Geminiviruses, in particular, hamper the SCF complex functions by removing the ubiquitin-like molecule from neddylated cullins (Lozano-Duran and Bejarano, 2011). More recently, it has been demonstrated that the replication initiator protein (Rep) of the geminivirus, Chilli leaf curl virus, interacts with the host UPS and promotes transcription of the viral genome (Kushwaha et al., 2017).

Geminiviruses are circular, single-stranded plant DNA viruses that are transmitted by the whitefly, Bemisia tabaci Genn., and infect a variety of crops globally. They belong to the family Geminiviridae which comprises of 9 genera, of which the Begomovirus genus is the largest (Zerbini et al., 2017). Begomoviruses significantly contribute to reduced production of economically and nutritionally important crops by causing diseases such as Pumpkin yellow mosaic disease, Tomato yellow vein streak disease, Bean dwarf mosaic disease, Sweet potato leaf curl disease, Squash mild leaf curl disease, and Cassava mosaic disease (Ramesh et al., 2017; Rey and Vanderschuren, 2017; Yang et al., 2019). Geminiviruses have the ability to reprogram host cellular processes for their own benefit (Voinnet et al., 1999; Hanley-Bowdoin et al., 2004; Hanley-Bowdoin et al., 2013; Wu et al., 2019), and one such process is ubiquitination (Kumar, 2019). They interfere with host UPSs to redirect protein metabolism, alter defense processes (Ramesh et al., 2017) and even suppress the plant’s response to insect vectors (Li et al., 2019). Geminiviruses have been known to inhibit proteasomal degradation of the viral silencing suppressor C2 protein, simultaneously target multiple E3 ligases, alter SUMOylation when the Rep protein interacts with SUMO-conjugating enzyme E1, and degrade of the movement protein (MP) (Alcaide-Loridan and Jupin, 2012).

One of the important geminivirus-induced diseases is Cassava Mosaic Disease (CMD), which is caused by a number of cassava mosaic begomovirus species, and produces foliar symptoms that include reduced leaf size, causing production of few or no tubers by the cassava (Manihot esculenta Crantz) plant (Alabi et al., 2011). CMD can result in yield losses of up to 100% in Africa alone (FAO, 2013), with major regional pandemics causing major food security destabilisation such as occurred in East and Central Africa in the 1990s (Legg and Thresh, 2000; Legg et al., 2006). Certain cassava genotypes exhibit resistance or tolerance to cassava mosaic begomoviruses, such as tropical M. esculenta 3 (TME3) and Tropical Manihot Series (TMS) 96/0023, whereas others (T200, TMS 8017) are susceptible to the virus and do not recover from infection (Rogans et al., 2016; Fondong and Rey, 2018). CMD resistance can be polygenic as is the case for CMD1 in wild cassava (Manihot glaziovii), reportedly monogenic dominant as in CMD2 in certain West African cassava landraces (Akano et al., 2002), or a cross of CMD1 and CMD2 to produce CMD3 (Lokko et al., 2006). Traditionally, CMD-resistant cultivars have been bred by introgression and marker-assisted breeding of resistant landraces with preferred cassava cultivars (Jennings, 1994; Legg and Thresh, 2000; Okogbenin et al., 2007; Ceballos et al., 2015; Nzuki et al., 2017). Genetic modification of cassava for introduction of resistance traits has been hampered by the plant’s recalcitrance to transformation (Zainuddin et al., 2012; Lentz et al., 2018). It has been posited that the use of 21st century genetic engineering (GE) or editing techniques such as artificial miRNA, transactivating siRNA, and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), to improve native antiviral mechanisms, can confer virus resistance without adverse effects on the plant (Vanderschuren et al., 2006; Fondong & Rey 2018). However, this will depend on an intimate understanding of the molecular processes of existing innate antiviral mechanisms, such as the degradation of viral proteins that is directed by the UPS. In this respect, CRISPR has the upper hand over other modern GE techniques because of its efficiency in silencing genes, which simplifies the process of identifying key genes involved in resistance/tolerance by analysing gene expression during virus infection (Doudna and Charpentier, 2014; Mao et al., 2018).

Transcriptome studies during infection have shown that the geminivirus, South African cassava mosaic virus, and Cassava brown streak virus (ssRNA ipomovirus) induce differential expression of UPS proteins, including four E3 ligases (Allie et al., 2014; Maruthi et al., 2014). A genome-wide association study found one E3 ligase (Manes.12G069400/cassava4.1_026906 m.g) among 105 gene candidates associated with the CMD2 locus (Wolfe et al., 2016). This E3 ligase (hereafter designated MeE3L) is located on a major CMD resistance-associated QTL (Lozano et al., 2015) and has been implicated in cassava’s response to drought conditions (Liao et al., 2016; Patanun et al., 2016). To test whether MeE3L is involved in the response of cassava to South African cassava mosaic virus (SACMV), we set out to determine how the transient expression of MeE3L and SACMV replication in cassava protoplasts from model cultivar (cv.60444), susceptible (T200) and tolerant (TME3) landraces (Kuria et al., 2016) are affected by CRISPR-mediated gene editing of MeE3L.

1. CRISPR-Cas9 vector construction

Two genomic gRNA targets were identified using the CRISPOR version 4.7 web-based program (www.crispor.tefor.net; Haeussler et al., 2016) and used in designing duplex sgRNA that included an Arabidopsis thaliana U6-26 promoter, the sgRNA scaffold and terminator for each gRNA sequence. Synthesis of the duplex sgRNA was outsourced to Inqaba Biotech (Pretoria, South Africa) and the duplex was cloned into the pCambia1380 vector. A Cas9 insert (Tobacco mosaic virus promoter + Cas9 gene + eGFP gene + Hsp terminator) from the pl1m-f2-p35s-cas9-egfp-nucleo-thsp Golden Gate vector was cloned into the pCambia1380-gRNA construct. The construct was confirmed by restriction digestion and sequencing.

2. Protoplast isolation

Sterile nodal cultures of cassava (cv.60444, T200 and TME3 genotypes) were grown for 4 weeks at 28 °C (3,000 lux; 12/12 h light/darkness) on ½ Murashige and Skoog (MS) medium (2.2 g Murashige and Skoog Basal Medium, 2% sucrose, 0.002 mM CuSO₄, 0.78% plant tissue culture agar) (Murashige and Skoog, 1962) to provide 3 biological replicates of each genotype. For each treatment, 0.3 g of fully expanded leaves were transversely sliced into 2–3 mm strips, which were plasmolysed by immersion in CPW9M medium (0.5 M mannitol, 27.2 mg KH₂PO₄, 100 mg KNO₃, 150 mg CaCl₂, 250 mg MgSO₄, 2.5 mg Fe₂(SO₄)₃.6H₂0, 0.6 mg KI, 0.00025 mg CuSO₄ per litre; pH 5.8) for 1 h (Anthony et al., 1995). The strips were vacuum-infiltrated in enzyme digestion solution (5 mM morpholinoethanesulphonic acid (MES), 0.4% cellulase, 0.2% macerozyme, CPW9M medium) for 30 min and then incubated at 25 °C in the dark at 40 rpm for 16 h. Protoplasts were released by shaking the digested tissue at 80 rpm for 5 min and purified by filtering through a 75 µm sieve. The filtrate was centrifuged at 100 g and the protoplast pellet washed twice in CPW9M medium. Protoplast integrity was checked using the Olympus BX 63 OM/FM microscope (Olympus Scientific Solutions, Massachusetts, USA), viability was determined by Evans’ Blue Dye staining (Huang et al., 1986), and quantification conducted via flow cytometry using the BD Accuri™ C6 flow cytometer (BD Biosciences, New Jersey, USA). Flow cytometric data were analysed using FCS Express 7 Research Edition software (Treestar, Inc, Oregon, USA). Protoplasts were resuspended in MMg solution (0.4 M mannitol, 15 mM MgCl₂, 4 mM MES; pH 5.8) (Wu et al., 2017) to a concentration of 10⁴ cells per ml.

3. Protoplast transfection

Approximately 15 µg of the CRISPR construct and 4 µg each of pBIN19-SACMV-DNA-A and pBIN19-SACMV-DNA-B infectious clones (Berrie et al., 2001) were mixed with 1 mL of protoplasts and 25% polyethylene glycol 4000 (PEG 4000), and incubated at room temperature for 20 min. The mixture was gently diluted with 3 volumes of W5 solution (154 mM NaCl, 125 mM CaCl₂, 5 mM KCl, 2 mM MES, pH 5.8) and centrifuged twice at 100 g for 2 min. Protoplasts were resuspended in 300 µL of WI solution (4 mM MES, 0.5 M mannitol, 20 mM KCl, pH 5.8) (Yoo et al., 2007) and incubated overnight in the dark at room temperature to induce gene expression. The expression of eGFP was checked using fluorescence microscopy to confirm protoplast transformation. Protoplasts were washed with CPW9M medium at 24 h post-transfection.

4. Mutagenesis, viral load and gene expression assays

DNA was extracted from the transformed protoplasts 24 h post-transfection (hpt) using QIAzol Lysis Reagent according to a user-developed protocol (www.qiagen.com/it/resources/) (Qiagen, Maryland, USA). Quantitative PCR (qPCR) for SACMV relative viral load quantitation using DpnI-digested (ThermoFisher Scientific, Massachusetts, USA) DNA as template was performed in triplicate using forward (5` GGCTAGTTCCCGGATTACAT 3`) and reverse (5` GACAAGGACGGAGACACC 3`) primers, and 18S rRNA as the reference gene. The exonic region of MeE3L was amplified using the Phusion U Green Hot Start DNA Polymerase (ThermoFisher Scientific) with forward (5` CGCGCAGATTCAAGC 3`) and reverse (5` TGTCCACATGGAATGAAAG 3`) primers. Sequencing of amplicons on the ABI 3500XL Genetic Analyzer was outsourced to Inqaba Biotec (Pretoria, South Africa), and sequencing results were analysed for variation and alignment using TIDE web tool (https://tide.deskgen.com/; Brinkman et al., 2014) and MAFTT version 7 (https://mafft.cbrc.jp/alignment/software/; Rozewicki et al., 2019) before being employed as query terms for protein structure and binding prediction using the I-TASSER On-line Server (https://zhanglab.ccmb.med.umich.edu/I-TASSER/; Yang and Zhang, 2015) and protein similarity search in the Protein Data Bank (Berman et al., 2000). Analysed sequences were used as query terms for BLAST (https://blast.ncbi.nlm.nih.gov/; Zhang et al., 2000) searches of the SACMV genome (AF155806/7) and to construct a phylogenetic tree using the MEGA X software based on the Maximum Likelihood method and Jones-Taylor-Thornton (JTT) matrix-based model (Kumar et al., 2018).

RNA was extracted from the transformed protoplasts 24 hpt using QIAzol and according to the manufacturer’s (Qiagen, Maryland, USA) protocol. First strand cDNA synthesis using RNA as template was performed using the RevertAid H Minus First Strand cDNA Synthesis Kit (ThermoFisher Scientific, Massachusetts, USA). Reverse transcriptase qPCR for MeE3L relative expression quantitation was performed in triplicate with cDNA as template using the Maxima SYBR Green/ROX qPCR Master Mix (2X) (ThermoFisher Scientific, Massachusetts, USA) with forward (5` CGCGCAGATTCAAGC 3`) and reverse (5` TGTCCACATGGAATGAAAG 3`) primers according to the manufacturer’s protocol using 18S rRNA was the reference gene for qPCR. Relative expression and viral load of MeE3L and SACMV, respectively, were determined using the 2^−ΔΔT method (Livak and Schmittgen, 2001).

1. Isolation and transformation of cassava protoplasts

The in vitro growth of the cassava plantlets was conducted under controlled, sterile conditions and only young, expanded leaves were used as donors (Fig. 1A). Different sizes (~ 15–35 µm) of cassava protoplasts of round and irregular shape, containing one vacuole and chloroplasts, were observed (Fig. 1B-D). The viability of protoplasts was at least 85% as shown by staining with Evans’ Blue Dye (Fig. 2A-C). Protoplast yields were 4.90–6.36 × 10⁶/g fresh weight (FW) (Additional File 1). The integrity of isolated protoplasts was analysed by flow cytometry prior to transfection (Fig. 2D-F). The presence of protoplasts as well as irregularly-shaped debris outside the gated area was detected. Approximately 10⁴ protoplasts of each cassava genotype were transfected with 15 µg eGFP-tagged CRISPR construct and/or 4 µg SACMV infectious clones using PEG-mediated transformation. Stability of transient expression was verified by detection of eGFP expression 24 hpt, showing that at least 90% of protoplasts had been successfully transformed (Fig. 2G-H).

Cassava protoplast isolation from leaf mesophyll cells by 16 h-long enzymatic digestion. (A)M. esculenta4-week old donor plants cultured on ½ Murashige and Skoog medium. (B) Protoplasts fromM. esculentacv.60444 (C) Protoplasts from susceptibleM. esculentaT200 (D) Protoplasts from tolerantM. esculentaTME3. Spherical protoplasts with chloroplasts around the edge of the cell membrane and central vacuole were observed (shown by red arrows). Protoplasts were visualised under bright field microscopy.

Analyses of viability, quality and transformation of cassava protoplasts. Viability of freshly isolated protoplasts was determined by Evans’ Blue Dye staining and visualisation under bright field microscopy. Analysis of protoplast quality was done by flow cytometric density measurement where events are discriminated by size and granularity, represented in log scale density plots. The size and shape of cassava protoplasts are measured by their effect on the forward scatter (FSC-A) and side scatter (SSC-A) of the laser. Stable transformation with the CRISPR construct was determined by fluorescence microscopy visualisation of eGFP fluorescence through the GFP filter and/or bright field. (A) Protoplasts fromM. esculentacv.60444; (B) Protoplasts fromM. esculentaT200 (C); Protoplasts fromM. esculentaTME3. Non-viable cells are stained blue. (D) Plot ofM. esculentacv.60444 protoplast density (E) Plot ofM. esculentaT200 protoplast density (F) Plot ofM. esculentaTME3 protoplast density. Circled regions correspond to desirable protoplasts. (G)M. esculentaT200 protoplasts visualised through the GFP filter (H)M. esculentaT200 protoplasts visualised through both the bright field and GFP filters.

2. Structure and phylogenetic analysis ofMeE3Lin model, susceptible and tolerant cassava genotypes

PCR amplification and sequencing of the MeE3L partial transcript from leaves revealed that the T200 landrace homolog is slightly longer than the TME3 homolog (Fig. 3B). Sequencing of the exonic region of T200 MeE3L showed that this is due to a 53 bp insertion mutation of 9 TGAGAA nucleotide repeats that are absent in cv.60444 and TME3 (Fig. 3A). The resulting frameshift introduces a stop codon at amino acid 141 (Fig C-D). Computational analysis revealed that the truncated T200 MeE3L homolog is structurally distinct from the reference (AM560-2), cv.60444 and TME3 MeE3L homologs (Fig. 3E). It is also not significantly similar in structure to any protein in the Protein Data Bank (Berman et al., 2000), and it is not confidently predicted to bind any ligands. The other three (AM560-2, cv.60444 and TME3) homologs are structurally closest to the cIAP1 inhibitor of apoptosis protein which contains a RING domain with E3 ligase activity for autoubiquitination and modulates cell death (Dueber et al., 2011). An analysis of the phylogeny of E3 ligase homologs in plants (Fig. 3F) reveals that although the MeE3Ls share Hevea brasiliensis as a common ancestor, the T200 homolog is significantly more evolutionarily distant from AM560-2 than the TME3 and cv.60444 homologs.

Primary structure, secondary structure and phylogenetic analysis ofMeE3Land/or its protein product. Sequence alignment and agarose gel resolution ofMeE3Lpartial gene and partial transcript respectively show a 53 bp insertion mutation in the lengthier T200 homolog that is absent in the AM560-2, cv.60444 and TME3 homologs. Computational prediction of secondary, molecular and zinc-binding structures of MeE3L homologs shows significant differences between T200 structure and the other structures. N→C. Phylogenetic analysis shows significant evolutionary distance between T200 MeE3L and other plant MeE3L homologs. (A) Genomic nucleotide sequence alignment showing insertion mutation between nucleotides 397–398 and 422–423 in the T200MeE3Lhomolog (B) Agarose gel resolution of the PCR-amplified T200 and TME3 partial transcripts ofMeE3L(C) Amino acid sequence alignment showing premature stop mutation at amino acid residue 141 in T200 MeE3L protein homolog (D) The reference (M. esculentaAM560-2) MeE3L amino acid sequence. Asterisks denote stop codons in T200 (amino acid residue 141) and AM560-2/cv.60444/TME3 (amino acid residue 200) homologs respectively. Red letters denote the first T200 MeE3L stop mutation at amino acid residue 141. Underlined letters denote the sequence adhering to the RING finger domain consensus sequence [CX₂CX₍₉₋₃₉₎CX₍₁₋₃₎HX₍₂₋₃₎CX₂CX₍₄₋₄₈₎CX₂X].(Ei) AM560-2 MeE3L homolog predicted secondary structure (Eii) AM560-2 MeE3L homolog predicted tertiary molecular structure (Eiii) Zinc binding in RING domain of AM560-2 MeE3L (Eiv) cv.60444 MeE3L homolog predicted secondary structure (Ev) cv.60444 MeE3L predicted tertiary molecular structure (Evi) Zinc binding in RING domain of cv.60444 MeE3L (Evii) T200 MeE3L homolog predicted secondary structure (Eviii) T200 MeE3L predicted tertiary molecular structure (Eix) Predicted ligand binding structure of T200 MeE3L (Ex) TME3 MeE3L homolog predicted secondary structure (Exi) TME3 MeE3L predicted tertiary molecular structure (Exii) Zinc binding in RING domain of TME3 MeE3L [Predictions were run on the I-TASSER On-line Server (https://zhanglab.ccmb.med.umich.edu/I-TASSER/; Yang and Zhang, 2015)] (F) Evolutionary analysis of plant MeE3L homologs using Maximum Likelihood method and Jones-Taylor-Thornton (JTT) matrix-based model in MEGA X (Kumar et al., 2018). Bootstrap support was calculated from 1000 replicates. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.

3. Relative accumulation of SACMV DNA and relativeMeE3Lexpression in transformed cassava protoplasts

Relative SACMV DNA accumulation in wild-type protoplasts was highest in T200 at 8-fold, compared to 3-fold in cv.60444 and TME3 at 24 hpt. Gene editing of MeE3L by CRISPR (Additional File 1) resulted in a substantial increase in accumulation of SACMV in T200 and TME3 (12-fold and 4-fold respectively) whereas only a 1-fold reduction was seen in cv.60444 (Fig. 4A). MeE3L expression is significantly upregulated with a log fold change of 1 and 9 in T200 and TME3 SACMV-infected protoplasts, respectively. Gene editing of MeE3L significantly upregulated expression of the MeE3L variant in TME3 but had no significant effect on T200 MeE3L expression under the different transformation conditions. No significant change in MeE3L expression was observed under all conditions in cv.60444 (Fig. 4B).

4. Predicted MeE3L primary structure in transformed cassava protoplasts

Predicted MeE3L protein primary structures based on the MeE3L genomic sequence in SACMV-infected protoplasts showed virus-induced stop mutations (amino acid residues 133 and 99 respectively) (Fig. 4C-D) upstream of the RING domain in cassava T200 and TME3 variants, compared to uninfected controls and reference sequence AM560-2. Sequencing of MeE3L from SACMV-infected and/or gene-edited TME3 protoplasts revealed multiple random single base mutations along the length of MeE3L which translate to substitutions by altered amino acids (Fig. 4E).

Assessment of viral DNA accumulation, relativeMeE3Lexpression, and predicted MeE3L primary structure in transformed cassava protoplasts. (A) Relative DNA accumulation of SACMV- and SACMV + CRISPR-Cas9-transformed cassava protoplasts under different transformation conditions. ΔMeE3L = mutant CRISPR-editedMeE3L. Real-time qPCR was performed usingDpnI-treated total DNA extracted from cassava protoplasts 24 hpt as template. (B)MeE3Lrelative expression levels in transformed cassava protoplasts. V = SACMV-transformed. ΔMeE3L = gene-editedMeE3L. RT-qPCR was performed using total mRNA as template. (C) Stop mutation induced in SACMV-infected T200MeE3L. (D) Stop mutation induced in SACMV-infected TME3MeE3L. (E) The predicted amino acid sequence of TME3 MeE3L at reference sequence positions 2-148 showing multiple mutations in SACMV-infected variant. V = SACMV-infected. C = gene-edited. Sequence alignment was conducted in MEGA-X (Kumar et al., 2018).

1. African cassava landraces susceptible and tolerant to SACMV are amenable to enzymatic protoplast isolation and PEG-mediated transformation

Protoplasts were chosen for this transient gene expression study because they can conveniently and efficiently be transformed with several DNA constructs simultaneously, and they allow higher resolution imaging compared to cells in intact tissue (Faraco et al., 2011). Additionally, they can be used for high throughput efficient screening of many candidate genes, and those that show an effect can then be silenced by CRISPR or virus induced gene silencing (VIGS) in planta, which are considerably longer (3-4 months) and more complicated procedures for the non-model host cassava. Leaf mesophyll was used as the source for protoplasts because it provides functional information about proteins expressed in other plant organs (Faraco et al., 2011). Round and irregularly-shaped protoplasts of different sizes were observed (Fig.1B-D), although generally leaf mesophyll protoplasts should be uniformly spherical (Wu et al., 2017).

A previously determined enzyme concentration (1.6% cellulase, 0.8% macerozyme) that is suitable for obtaining the optimum number of viable protoplasts was used for leaf digestion (Wu et al., 2017). The viability of protoplasts in this study was at least 85% although cassava protoplast viability of up to 95% has been reported (International Plant Research Institute, 1984). The long digestion period (16 h) was ruled out as the cause of death for ~15% of protoplasts as this reportedly does not induce serious damage in protoplasts (Tang, 1982). It has been reported that micro-propagated plants grown in vitro lack epicuticular wax and thus allow rapid enzyme penetration (Kumar and Rao, 2018). Cassava, however, has a thick epicuticular layer which necessitates the long digestion period of 16h compared to 0.3-1h for Arabidopsis (Wu et al., 2009). Macerating enzymes such as macerase are known to cause wound reactions in protoplasts because of their degradation of the cell wall, which may lead to necrosis (Ishii, 1988), while cellulase is known to exert inadequate enzymatic activity at low concentrations and higher concentrations have no benefit or detriment (Uchimiya and Murashige, 1974). Therefore, a balance between digestion enzyme concentration and viability is essential in order to obtain the optimum yield of viable good quality protoplasts. The difference in cassava protoplast viability from previously reported percentages possibly may vary according to cassava variety, and in this case could be due to the particular physiological characteristics of the African cassava landraces from which protoplasts were derived in this study.

Although lower than the previously reported yields of 4.4x10⁷ protoplasts/g FW leaves from M. esculenta cv. South China 8 (Wu et al., 2017) and 1.9x10⁷ protoplasts/g FW leaves from M. esculenta cv. M. Thai 8 (Anthony et al., 1995), the protoplast yields in this present study (4.90-6.36x10⁶/g FW) were sufficient to provide the recommended number of protoplasts (10⁴-10⁷) required for each transfection (Yoo et al., 2007). Both pre-treatment of leaves in the dark (24-72 h) (Shahin and Shepard, 1980) and vacuum infiltration before enzyme digestion (Nanjareddy, 2016) were shown to intensify enzyme penetration in bean leaves. We found that pre-treatment resulted in release of much undesirable plant debris alongside protoplasts, and that vacuum infiltration did indeed help increase protoplast yield. Flow cytometry indicated a high concentration of protoplasts compared to irregularly-shaped debris. Based on microscopy images of purified protoplasts (Fig.1B-D), the irregular debris outside the gates was deemed to be free chloroplasts, plasmolysed cells, undigested cell wall fragments and other aggregates arising from the long digestion period of leaf material.

PEG-mediated plant protoplast transfection with plasmid DNA is a well-established procedure (Hayashimoto et al., 1990; Locatelli et al., 2003) and a popular protocol uses 10 μg DNA to transfect 2x10⁴ Arabidopsis protoplasts (Yoo et al., 2007). At least 5 µg of plasmid DNA have previously been used to transform 10⁶tobacco protoplasts with African cassava mosaic virus (ACMV) (Ermak et al., 1993) and Cowpea mosaic comovirus (Wellink et al., 1993). Highly efficient co-expression of multiple constructs has been reported (Chen et al., 2006; Walter et al., 2004). Virus infectious clones have also been used in conjunction with other plasmid constructs for co-inoculation of plant protoplasts. Nicotiana tabacum protoplasts have been co-transformed with 5 µg eGFP construct, 3 μg siRNA and 4 μg each of ACMV or East African cassava mosaic virus (EACMV) with DNA/RNA extraction at 36 and 48 hpt (Vanitharani et al., 2003). To our knowledge, the present study is the first report of co-transformation of cassava protoplasts with a CRISPR construct and geminivirus infectious clones.

2. **The M. esculenta T200 MeE3L encodes a truncated RING-less protein due to a nonsense mutation**

The frameshift resulting from the insertion mutation in T200 MeE3L introduces a stop codon upstream of the RING domain, thus encoding a truncated protein in which the C3HC4-type RING finger motif is absent. Essentially, the E3 ligase domain in the T200 MeE3L would not be translated because of this mutation, making its potential protein product non-functional with respect to this E3 ligase activity. There is evidence that intronic GAA repeats impede transcription via the assembly of an inaccessible chromatin structure (Punga and Buhler, 2010). However, we amplified the T200 MeE3L exon from cDNA, showing that this gene is transcribed. It is more likely that the premature translation termination instruction makes the T200 MeE3L a possible candidate for nonsense-mediated mRNA decay (NMD) whereby mRNAs with long 3′-untranslated regions (UTRs) are targeted as substrates for degradation (Hori and Watanabe, 2005). In Arabidopsis, for example, evolutionarily conserved protein factors are deployed by the NMD system where the 3′-UTR is less than 300 nucleotides (Hori and Watanabe, 2007).

It is proposed that the loss of a substantial portion of the T200 MeE3L C-terminal region would alter the spatial chemical conformation necessary for any other interactions (such as binding the ubiquitin-conjugated E2 and substrate) to occur. Furthermore, the possible non-functionality of the T200 MeE3L due to the nonsense mutation would suggest that the susceptibility of T200 to SACMV might be linked the loss of the RING domain since this is where the E3 ligase activity resides. However, susceptible cv.60444 encodes a functional RING domain in its MeE3L, suggesting that susceptibility to the virus is subject to at least another pathway besides that in which MeE3L is involved, or is under polygenic control.

The structural similarity between between MeE3L and cIAP1 is significant because IAPs are known for contributing to disease initiation, maintenance or progression by controlling protein stability (Silke and Meier, 2013). Binding of a substrate to cIAP1 leads to activation of the E3 ligase, leading to activation of downstream caspases which set cell death in motion (Berger et al., 2006). Viruses tend to inhibit host apoptotic responses in a bid to prolong cell viability and facilitate replication by targeting caspases for suppression. However, because caspases also play a role in cell proliferation and differentiation, some viruses stabilise caspase activity to maintain cell survival of the cell at a particular differentiation stage, or to facilitate replication by suppressing early apoptosis (Lee, Liao and Lin, 2005; Best, 2008). Reduced viral yield has been reported in a case where specific caspases were inhibited, suggesting that these caspases expedite viral replication (Best, Wolfinbarger and Bloom, 2002). It is suggested that silencing of the MeE3L RING domain would promote caspase activity in the susceptible T200 genotype, thereby enhancing pathogenicity by aiding SACMV replication.

The AM560-2, TME3, and cv.60444 cassava genotypes have previously been shown to cluster together under their nearest ancestor, Hevea brasiliensis (Bredeson et al., 2016). The evolutionary history of T200, a southern African landrace, is unknown and the phylogenetic analysis suggests that the T200 MeE3L evolved after the cv.60444 and TME3 variants. While it is known that wild plants in natural ecosystems may co-evolve with their virus partners, information regarding how viruses apply selective pressure to increase plant susceptibility is not known. A study of Drosophila and its host-specific viruses found that coevolution may cause sustained genetic variation in susceptibility. This may explain why a southern African cassava landrace is highly susceptible to SACMV that appears to have migrated south from its origin, suspected to be in east Africa or the south-west Indian Ocean islands such as Madagascar (De Bruyn et al., 2016) that were once geographically attached to the African continent (Lefeuvre et al. 2007). South African cassava mosaic virus is a recombinant between East African cassava mosaic virus and two other unknown geminiviruses which contributed the AC4 and IR regions (Berrie et al., 2001), and moved southwards into Mozambique, Zimbabwe and South Africa where it may have encountered the T200 landrace. Subsequent to its first discovery in South Africa, it has been reported in Zimbabwe (Briddon et al. 2004) and Madagascar (De Bruyn et al., 2016). It is suggested that the T200 landrace and SACMV may still be in the process of co-adaption, which would be why T200 exhibits extreme susceptibility to SACMV. It is known that infection with a new recombinant begomovirus requires hosts to adjust to minor or major differences in virus-host interactions (Montes et al., 2019). We speculate that maybe the MeE3L is either a paralog in T200 or it was introgressed from a wild relative in southern Africa.

3. MeE3L affects SACMV DNA accumulation in a genotype-dependent manner

Quantitative PCR is a well-established method for precise quantitation of viral DNA amount in infected tissue and it requires a host reference gene with stable expression patterns under experimental conditions as the internal control for correct data normalisation (Moreno et al., 2011). Quantitative detection of African cassava mosaic virus and East African cassava mosaic virus using real time -qPCR has been reported (Otti et al., 2013) and SACMV load, in particular, has been assayed in planta in Arabidopsis (Pierce and Rey, 2013) and cassava (Allie, 2014). Replication of the geminivirus, Cassava brown streak virus, in cassava leaf mesophyll protoplasts has been assayed at 6 hpt (Anjanappa et al., 2016) and it has been reported that there was significant viral DNA accumulation in tobacco BY-2 protoplasts 36 and 48 hpt by co-inoculating with infectious ACMV and EACMV clones and siRNA (Vanitharani et al., 2003). Our finding that SACMV DNA accumulates in cassava protoplasts correlates well with these reports.

It was expected that viral DNA accumulation would be significantly lower in TME3 than in the susceptible cv.60444 and T200 if MeE3L was involved in tolerance since the TME3 landrace is known to have the CMD2 locus. Evidently, CRISPR-induced mutations in MeE3L in cassava protoplasts differentially affect viral DNA accumulation based on the cassava genotype. CRISPR-associated modification of the MeE3L structure and subsequent disruption of its activity may enhance SACMV DNA accumulation and pathogenicity in T200 and TME3 by interfering with the UPS-dependent tolerance/resistance response mechanisms of cassava.

4. Viral activity and gene editing of MeE3L affect the expression of MeE3L

Geminiviruses elude plant defense mechanisms by hijacking and redirecting ubiquitination, and interfering with responses regulated by ubiquitin E3 ligases (including responses to jasmonates, auxins, gibberellins, ethylene,abscisic acid) (Lozano-Duran et al., 2011). It follows then that alterations to E3 ligase genomic sequences may alter E3 ligase expression patterns during viral infection, as viruses are known to modulate RNA levels to enhance infection (Verchot, 2016). Both plant viruses and CRISPR systems are known to induce mutations in the genome (Machida et al., 2004; Cougot et al., 2005; Sander and Joung, 2014), and the employment of both against the MeE3L would provide an indication of how this gene is involved in the plant’s response to SACMV.

Results indicate that in TME3 protoplasts, MeE3L expression is upregulated during SACMV infection. The concurrent CRISPR-mediated gene editing of MeE3L and infection with SACMV appears to induce increased expression of the MeE3L, suggesting that the interaction between the virus and MeE3L is based on recognition of the MeE3L’s specific base sequence. Previously, plant E3 ligases have been shown to be induced by viral infection (Lai et al., 2009; Czosnek et al., 2013; Chen et al., 2018) and plant defence elicitors (Libault et al., 2007; Sadanandom et al., 2012). The muted response of the T200 MeE3L to all treatments was expected given its nonsense mutation which silences the RING domain responsible for E3 ligase activity. However, the muted response of susceptible cv.60444 MeE3L was unexpected and suggests that this MeE3L sequence variant is not responsive to SACMV infection. It is possible that downstream plant hormone responses may be linked to MeE3L activity. It is known that geminiviruses interact with plant E3 ligases and induce their up- or down-regulation to promote infection or undergo degradation. Beet severe curly top virus (BSCTV) C4 induces activity of RING E3 ligase, RKP, to interfere with the cell cycle, increase susceptibility and promote infection (Lai, 2009). The C2 protein interacts with CSN5, a component of the SCF E3 ligase complex, to alter CUL1’s regulation of plant hormones (Lozano-Duran et al., 2011). An F-box protein adaptor is triggered to overexpress by Tomato yellow leaf curl Sardinia virus (TYLCSV) and hence the virus co-opts SCF E3 ligase activity (Lozano-Duran and Bejarano, 2011). The geminiviral βC1 protein is ubiquitinated by E3 ligase, NtRFP1, for degradation and resultant attenuation of symptoms. Conversely, βC1 is able to interact with NbSKP1 to impair the SCF complex integrity and hence enhance symptom induction by interfering with jasmonic acid and gibberellic acid signalling. Evidently, geminiviruses can usurp the UPS by preventing E3 ligases from targeting viral proteins; or they can redirect the UPS to degrade host resistance-related proteins.

The MeE3L homolog sequences in SACMV-infected protoplasts show that SACMV is actively inducing silencing of the RING domain in order to achieve full infection of the host. The concomitant increase in SACMV DNA accumulation and CRISPR-mediated editing of MeE3L in TME3 shows that the interaction of MeE3L with SACMV is more directed at advancing susceptibility. One other plant E3 ligase, RHF2A, is silenced by TYLCSV to promote infection (Lozano-Duran et al., 2011). It has also been shown that inhibition of a RING E3 ligase impairs plant defence during Cabbage leaf curl virus (CaLCuV) infection (Sahu et al., 2013) and that silencing of tobacco RING E3 ligase, NtRFP1, leads to development of severe symptoms during Tomato yellow leaf curl China virus (TYLCCV) (Shen et al., 2016). The present study provides further evidence that geminiviruses interfere with expression of a plant E3 ligase in order to establish infection, and demonstrates for the first time that MeE3L in cassava is responsive to a cassava-infecting geminivirus, SACMV.

5. SACMV’s interaction with a tolerant cassava genotype induces numerous mutations in MeE3L

Functions of E3 ligases in regulating immunity systems are orchestrated at the interface of host-virus interactions (Zhang et al., 2018) and some of these interactions occur in the nucleus (Kushwaha et al., 2017). Sequencing of MeE3L from SACMV-infected TME3 protoplasts revealed multiple random single base mutations along the length of MeE3L, which translate to amino acid substitution (Fig. 4E). While these mutations do not alter the reading frame, they are apparently aimed at silencing the whole protein and not just the RING domain. The resulting disordered protein would presumably not only lack RING E3 ligase activity, but also the E2 and substrate binding activity.

Several viral proteins reportedly hinder E3 ligase function by encoding these E3 ligases in their viral genomes (Lai et al., 2009; Rosa-Diaz et al., 2013; Wang et al., 2013; Chen et al., 2018; Lozano-Duran and Bejarano, 2018). However, a blastn search for MeE3L homologs in the SACMV genome did not return any hits, thus ruling out the possibility that SACMV encodes a protein with E3 ligase activity as a strategy to target host proteins for degradation via the RNA silencing pathway. Since E3 ligases are frequently hijacked by different viruses (Jackson and Xiong, 2009), we suggest, based on the MeE3L mutations induced during SACMV infection, that MeE3L is one of the targets of SACMV-induced host reprogramming and plays a crucial strategic role in enhancing susceptibility. This is not a case of viral arrogation of MeE3L by SACMV to redirect the UPS to new targets but rather to inhibit its function. Interestingly, the discovery of these mutations in genomic DNA possibly point to a yet unknown geminivirus-induced host mechanism for genome editing. Some E3 ligases and viral proteins can localise to the nucleus, such as the tobacco E3 ligase, NtHUB1 which has a nuclear localisation sequence, is recruited by geminiviral Rep protein, and co-localises and interacts with the Rep protein to monoubiquitinate cellular chromatin and thus enable infection (Kushwaha et al., 2017). The viral coat protein, CP, also has a nuclear localisation signal, can localise in the nucleolus and nucleoplasm, and facilitates entry of ssDNA into the nucleus (Wang et al., 2017; Kumar, 2019). However, the mechanisms for these processes are yet to be investigated. Geminiviruses are known to induce the expression of genes related to repair of double-stranded breaks (DSBs) and DNA synthesis (Lozano et al., 2015), and to promote somatic homologous recombination (Richter et al., 2014). In spite of this evidence for geminiviral activity at the host genomic level, the mechanisms for these processes have not been fully investigated. However, this evidence provides a measure of support for our finding of gene mutation induction by SACMV in TME3.

6. The response of MeE3L to SACMV is virus- and host-specific

Ubiquitin ligases are abundant in plants and provide substrate specificity to target particular proteins. In Arabidopsis alone, RING E3 ligases make up 499 out of over 1,500 E3 ligases (Mazucotelli et al., 2006). A comparison of E3 ligase and E3 ligase complex-associated gene expression during other plant geminivirus infection studies (Additional File 2) was conducted to determine whether MeE3L’s response to SACMV is geminivirus-specific or host-dependent.

In susceptible cassava, E3 ligase expression is downregulated during SACMV infection at early, middle and late time points (12, 32 and 64 days post infection (dpi)) but there is no differential expression of E3 ligases in tolerant cassava at any time point (Allie et al., 2014). However, no differential expression of E3 ligases is recorded during SACMV infection of Arabidopsis which is susceptible (Pierce and Rey, 2013). A study of transcriptomic responses to geminivirus Tomato leaf curl New Delhi virus (ToLCNDV) infection in potato found that five E3 ligases in the susceptible cultivar and two in the tolerant cultivar are upregulated at 30 dpi (Jeevalatha et al., 2017) while the geminivirus Tomato yellow leaf curl virus (TYLCSV) has been shown to induce upregulation of E3 ligases in susceptible tomato at 42 dpi, except in the case of a CUL1 which is downregulated (Miozzi et al., 2014). A transcriptome study of Arabidopsis during geminivirus CaLCuV infection found that, out of 1570 E3 ligases, 149 were up-regulated and 23 were downregulated (Ascencio-Ibanez et al., 2008; Lozano-Duran et al., 2013). The CaLCuV AC2 protein, in particular, induces downregulation of two E3 ligases in Arabidopsis (Liu et al., 2014). These findings, together with the current study, prove that plant E3 ligase responses to geminivirus infection are neither uniform nor similar, but they vary according to the specific geminivirus and host involved in the interaction.

Responses of cassava to the ssRNA potyviruses Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV) with respect to E3 ligase expression variably show both downregulation and upregulation in the susceptible varieties. Interestingly, there is no differential expression of E3 ligases in resistant cassava varieties except in Kaleso where a CUL1 is upregulated and a RZPF34 is downregulated (Maruthi et al, 2014; Anjanappa et al., 2016; Amuge et al., 2017). This variable expression of E3 ligases with respect to the virus in the same host suggests that while responses to viral infection are host-dependent, they are also modulated according to the particular virus infecting the plant.

It appears that MeE3L, like other plant E3 ligases, is reprogrammed by SACMV in a manner that is virus-specific and host-dependent. Moreover, current evidence indicates that E3 ligase responses are more pronounced in the virus-susceptible plant varieties. SACMV infection in planta is associated with occurrence of severe symptoms leading to persistent severe infection in susceptible T200 and mild symptoms with recovery at 67 days post infection (dpi) in tolerant TME3 (Allie et al., 2014). The SACMV-induced genetic mutations and differential expression of MeE3L post-infection in TME3 and T200 indicate that it is one of the significant genes involved in the plant’s response to the virus, and the data shown herein suggest that the MeE3L-SACMV interaction is aimed at silencing the gene to promote viral activity. Although the mechanism for silencing of MeE3L by SACMV is not clear, we propose that the silencing of MeE3L is part of the SACMV-induced reprogramming of the UPS to inhibit ubiquitination and trigger a decrease in global ubiquitinated proteins. The subsequent developmental disturbance linked to reduced caspase activity would contribute to increased symptom severity, which is visible at 32 dpi. At 67 dpi in TME3, the homeostasis of ubiquitinated versus non-ubiquitinated proteins would be restored and the effects of SACMV on the UPS would be counteracted, leading to symptom decrease and plant recovery. Alternatively, it is possible that SACMV suppressors of RNA silencing (VSRs) such as C2 and C4 target E3 ligases, such as MeE3L in T200 and TME3, for silencing, thereby usurping the UPS and contributing to disease symptoms. In TME3, other defence mechanisms such as RNA silencing at 67 dpi (Rogans et al., 2016) and resistance (NLR) proteins (Louis and Rey, 2015) persist, which interfere and reduce the activity and replication of SACMV.

We have developed a simple and fast protocol for CRISPR-mediated transient gene expression assay in cassava protoplasts. While gene editing/knockout in cassava plants takes 6–8 months, our protoplast-based method takes 6 weeks to provide experimental data that is suitable for informing in planta functional genomics studies. The findings of this present study show that the MeE3L base sequence is a determinant of cassava’s response to SACMV, via a mechanism for virus-mediated recognition and/or interaction with MeE3L at the host genomic level. The response of the RINGless T200 MeE3L to virus infection suggests that the RING domain in the C-terminal region of MeE3L may be essential for defence against SACMV and this is why it is actively silenced by the virus, thus contributing to pathogenicity. In the case of MeE3L in susceptible cassava protoplasts, it appears that SACMV conducts a delicate balancing act both to prevent autoubiquitination by the MeE3L RING domain and to inhibit expression compared to the tolerant landrace in order to stabilise caspase activity for cell survival. Most importantly, this study reinforces previously reported evidence that E3 ligases are an integral component of how plants respond to geminivirus infection and provides further evidence of how E3 ligases may be exploited by geminiviruses to enhance susceptibility.

Sequencing and expression assaying of MeE3L in other CMD-resistant/tolerant cassava genotypes would help further unravel MeE3L’s role in the response presented by cassava against SACMV. CRISPR multiplexing for high throughput targeting of candidate genes implicated in the SACMV-cassava interaction would assist in creating functional networks to further map the molecular mechanisms underlying cassava’s response to SACMV.

AC4

post-transcriptional gene silencing suppressor protein

ACMV

African cassava mosaic virus

APC

anaphase-promoting complex

APC2

APC Regulator of WNT Signaling Pathway 2

ASK

Arabidopsis SKP1-related

BLAST

Basic local alignment search tool

base pair

BSCTV

Beet severe curly top virus

BTB

bric a brac, tramtrack and broad complex

Transcriptional activator protein

post-transcriptional gene silencing suppressor protein

CaLCuV

Cabbage leaf curl virus

CCNF

cyclin F

cIAP1

Cellular inhibitor of apoptosis protein 1

CMD

Cassava mosaic disease

CPW9M

Cell and Protoplast Washing 9 Mannitol

CRISPR

Clustered regularly interspaced short palindromic repeats

CRL

Cullin ring

CUL1

Cullin 1

CUL4-DDB

cullin4-damaged DNA-binding protein

cultivar

DBS

double-stranded break

DDB1

DNA damage-binding protein 1

DNA

Deoxyribonucleic acid

dpi

days post infection

DUB

Deubiquitinating enzyme

EACMV

East African cassava mosaic virus

eGFP

Enhanced Green Fluorescent Protein

FAO

Food and Agriculture Organisation

fresh weight

gram

standard acceleration due to gravity

GFP

Green Fluorescent Protein

hour

HECT

Homologous to E6-associated protein C-terminus

hpt

hours post-transfection

Hsp

Heat shock protein

IAP

Inhibitor of apoptosis protein

intergenic region

I-TASSER

Iterative Threading ASSEmbly Refinement

JTT

Jones-Taylor-Thornton

µg

microgram

µM

micromolar

molar

MeE3L

Manihot esculenta E3 Ligase

MEGA X

Molecular Evolutionary Genetics Analysis X

milligram

min

minute

millilitre

millimolar

MMg

mannitol magnesium

N→C

amino terminus to carboxy terminus

NbSKP1

Nicotiana benthamiana S-phase kinase-associated protein 1

NLR

nucleotide-binding leucine-rich repeat

NMD

nonsense-mediated mRNA decay

NtHUB1

Nicotiana benthamiana homologous to ubiquitin protein 1

PCR

Polymerase chain reaction

PEG

polyethylene glycol

qPCR

Quantitative polymerase chain reaction

QTL

quantitative trait locus

R protein

resistance protein

RBR

RING-between-RING RING

RBX1

RING-box protein 1

Rep

Replication-associated protein

RHF2A

RING-H2 finger E3 ubiquitin ligase protein

RING

Really Interesting New Gene

RNA

Ribonucleic acid

rpm

revolutions per minute

rRNA

ribosomal RNA

RZPF34

RING zinc finger protein 34

SACMV

South African cassava mosaic virus

SCF

Skp, Cullin, F-box containing complex

sgRNA

single guide RNA

siRNA

small interfering RNA

ssRNA

single stranded RNA

T200

Tropical Manihot esculenta 200

TIDE

Tracking of indels by decomposition

TME3

Tropical Manihot esculenta 3

ToLCNDV

Tomato leaf curl New Delhi virus

TYLCCV

Tomato yellow leaf curl China virus

TYLCSV

Tomato yellow leaf curl Sardinia virus

UCBSV

Ugandan cassava brown streak virus

UPS

ubiquitin proteasome system

UTR

untranslated region

βC1

movement protein

Ethics approval and consent to participate

Not applicable

Consent to publication

Not applicable

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing Interests

The authors declare that they have no competing interests.

Funding

The study was supported by a National Research Foundation of South Africa Blues Skies grant for project ID 104829 and a Wits University Research Council postdoctoral fellowship grant. Funders played no role in in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Authors’ contributions

CR conceptualised the study. PC performed experiments, analysed results and wrote the manuscript. Both authors interpreted data, and read and approved the final manuscript.

Acknowledgements

The authors thank Prof Hervé Vanderschuren (University of Liège, Belgium) for the Cas9 vector, Prof Stefan FT Weiss (Wits University) for access to the flow cytometer, and the Microscopy and Microanalysis Unit (Wits University) for assistance with fluorescence microscopy.

Akano O, Dixon O, Mba C, Barrera E, Fregene M. Genetic mapping of a dominant gene conferring resistance to cassava mosaic disease [Internet]. 2002/05/08. Vol. 105, TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. Germany; 2002. p. 521–5. Available from: https://pubmed.ncbi.nlm.nih.gov/12582500.
Alcaide-Loridan C, Jupin I. Ubiquitin, Viruses P, Let’s Play Together! [Internet]. Vol. 160, Plant Physiology. 2012. p. 72 LP – 82. Available from: http://www.plantphysiol.org/content/160/1/72.abstract.
Allie F, Pierce EJ, Okoniewski MJ, Rey C. Transcriptional analysis of South African cassava mosaic virus-infected susceptible and tolerant landraces of cassava highlights differences in resistance, basal defense and cell wall associated genes during infection [Internet]. Vol. 15, BMC genomics. BioMed Central; 2014. p. 1006. Available from: https://pubmed.ncbi.nlm.nih.gov/25412561.
Amuge T, Berger DK, Katari MS, Myburg AA, Goldman SL, Ferguson ME. A time series transcriptome analysis of cassava (Manihot esculenta Crantz) varieties challenged with Ugandan cassava brown streak virus. Vol. 7, Scientific reports. 2017. p. 9747.
Anjanappa RB, Mehta D, Maruthi MN, Kanju E, Gruissem W, Vanderschuren H. Characterization of Brown Streak Virus-Resistant Cassava [Internet]. 2016/06/07. Vol. 29, Molecular plant-microbe interactions: MPMI. United States; 2016. p. 527–34. Available from: https://pubmed.ncbi.nlm.nih.gov/27070326.
10.1007/BF00030004
Anthony P, Davey MR, Power JB, Lowe KC. An improved protocol for the culture of cassava leaf protoplasts [Internet]. Vol. 42, Plant Cell, Tissue and Organ Culture. 1995. p. 299–302. Available from: https://doi.org/10.1007/BF00030004.
Ascencio-Ibáñez JT, Sozzani R, Lee T-J, Chu T-M, Wolfinger RD, Cella R, et al. Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection [Internet]. 2008/07/23. Vol. 148, Plant physiology. American Society of Plant Biologists; 2008. p. 436–54. Available from: https://pubmed.ncbi.nlm.nih.gov/18650403.
Barry M, Früh K. Viral modulators of cullin RING ubiquitin ligases: culling the host defense [Internet]. Vol. 2006, Science’s STKE: signal transduction knowledge environment. United States; 2006. p. pe21–pe21. Available from: https://pubmed.ncbi.nlm.nih.gov/16705129.
Berger AB, Witte MD, Denault J-B, Sadaghiani AM, Sexton KMB, Salvesen GS, et al. Identification of early intermediates of caspase activation using selective inhibitors and activity-based probes [Internet]. Vol. 23, Molecular cell. United States; 2006. p. 509–21. Available from: https://pubmed.ncbi.nlm.nih.gov/16916639.
10.1093/nar/28.1.235
Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The Protein Data Bank [Internet]. Vol. 28, Nucleic Acids Research. 2000. p. 235–42. Available from: https://doi.org/10.1093/nar/28.1.235.
Berrie LC, Rybicki EP, Rey MEC. Complete nucleotide sequence and host range of South African cassava mosaic virus: further evidence for recombination amongst begomoviruses. Vol. 82, The Journal of general virology. England; 2001. p. 53–8.
Best SM. Viral subversion of apoptotic enzymes: escape from death row [Internet]. Vol. 62, Annual review of microbiology. 2008. p. 171–92. Available from: https://pubmed.ncbi.nlm.nih.gov/18729734.
Best SM, Wolfinbarger JB, Bloom ME. Caspase activation is required for permissive replication of Aleutian mink disease parvovirus in vitro [Internet]. Vol. 292, Virology. United States; 2002. p. 224–34. Available from: https://pubmed.ncbi.nlm.nih.gov/11878925.
10.1038/nbt.3535
Bredeson JV, Lyons JB, Prochnik SE, Wu GA, Ha CM, Edsinger-Gonzales E, et al. Sequencing wild and cultivated cassava and related species reveals extensive interspecific hybridization and genetic diversity [Internet]. Vol. 34, Nature Biotechnology. 2016. p. 562–70. Available from: https://doi.org/10.1038/nbt.3535.
10.1111/j.0032-0862.2004.00963.x
Briddon RW, Robertson I, Markham PG, Stanley J. Occurrence of South African cassava mosaic virus (SACMV) in Zimbabwe [Internet]. Vol. 53, Plant Pathology. John Wiley & Sons, Ltd; 2004. p. 233. Available from: https://doi.org/10.1111/j.0032-0862.2004.00963.x.
Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition [Internet]. 2014/10/09. Vol. 42, Nucleic acids research. Oxford University Press; 2014. p. e168–e168. Available from: https://pubmed.ncbi.nlm.nih.gov/25300484.
Ceballos H, Kawuki RS, Gracen VE, Yencho GC, Hershey CH. Conventional breeding, marker-assisted selection, genomic selection and inbreeding in clonally propagated crops: a case study for cassava [Internet]. 2015/06/21. Vol. 128, TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. Springer Berlin Heidelberg; 2015. p. 1647–67. Available from: https://pubmed.ncbi.nlm.nih.gov/26093610.
10.1111/j.1364-3703.2006.00346.x
CHEN S, TAO L, ZENG L, VEGA-SANCHEZ ME, UMEMURA K, WANG G-L. A highly efficient transient protoplast system for analyzing defence gene expression and protein–protein interactions in rice [Internet]. Vol. 7, Molecular Plant Pathology. John Wiley & Sons, Ltd; 2006. p. 417–27. Available from: https://doi.org/10.1111/j.1364-3703.2006.00346.x.
Chen X, He Z, Fu M, Wang Y, Wu H, Li X, et al. The E3 Ubiquitin Ligase Siah-1 Suppresses Avian Reovirus Infection by Targeting p10 for Degradation. Vol. 92, Journal of virology. 2018.
Cougot D, Neuveut C, Buendia MA. HBV induced carcinogenesis. Vol. 34 Suppl 1, Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology. Netherlands; 2005. p. S75-8.
10.1093/jxb/erp059
Craig A, Ewan R, Mesmar J, Gudipati V, Sadanandom A. E3 ubiquitin ligases and plant innate immunity [Internet]. Vol. 60, Journal of Experimental Botany. 2009. p. 1123–32. Available from: https://doi.org/10.1093/jxb/erp059.
Czosnek H, Eybishtz A, Sade D, Gorovits R, Sobol I, Bejarano E, et al. Discovering host genes involved in the infection by the Tomato Yellow Leaf Curl Virus complex and in the establishment of resistance to the virus using Tobacco Rattle Virus-based post transcriptional gene silencing. Vol. 5, Viruses. 2013. p. 998–1022.
10.1186/s12862-016-0749-2
De Bruyn A, Harimalala M, Zinga I, Mabvakure BM, Hoareau M, Ravigné V, et al. Divergent evolutionary and epidemiological dynamics of cassava mosaic geminiviruses in Madagascar [Internet]. Vol. 16, BMC Evolutionary Biology. 2016. p. 182. Available from: https://doi.org/10.1186/s12862-016-0749-2.
10.1186/1471-2148-12-228
De Bruyn A, Villemot J, Lefeuvre P, Villar E, Hoareau M, Harimalala M, et al. East African cassava mosaic-like viruses from Africa to Indian ocean islands: molecular diversity, evolutionary history and geographical dissemination of a bipartite begomovirus [Internet]. Vol. 12, BMC Evolutionary Biology. 2012. p. 228. Available from: https://doi.org/10.1186/1471-2148-12-228.
Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9 [Internet]. Vol. 346, S (New York, N.Y.). United States; 2014. p. 1258096. Available from: https://pubmed.ncbi.nlm.nih.gov/25430774.
Dueber EC, Schoeffler AJ, Lingel A, Elliott JM, Fedorova AV, Giannetti AM, et al. Antagonists induce a conformational change in cIAP1 that promotes autoubiquitination [Internet]. Vol. 334, Science (New York, N.Y.). United States; 2011. p. 376–80. Available from: https://pubmed.ncbi.nlm.nih.gov/22021857.
Duplan V, Rivas S. E3 ubiquitin-ligases and their target proteins during the regulation of plant innate immunity [Internet]. Vol. 5, Frontiers in plant science. Frontiers Media S.A.; 2014. p. 42. Available from: https://pubmed.ncbi.nlm.nih.gov/24592270.
Ermak G, Paszkowski U, Wohlmuth M, Mittelsten Scheid O, Paszkowski J. Cytosine methylation inhibits replication of African cassava mosaic virus by two distinct mechanisms [Internet]. Vol. 21, Nucleic acids research. 1993. p. 3445–50. Available from: https://pubmed.ncbi.nlm.nih.gov/7688453.
FAO. Save and grow: Cassava - a guide to sustainable production intensification. 2013. p. 78.
Faraco M, Di Sansebastiano G, Pietro, Spelt K, Koes RE, Quattrocchio FM. One protoplast is not the other! [Internet]. 2011/03/31. Vol. 156, Plant physiology. American Society of Plant Biologists; 2011. p. 474–8. Available from: https://pubmed.ncbi.nlm.nih.gov/21454800.
Fondong VN, Rey C. Recent Biotechnological Advances in the Improvement of Cassava. In: Waisundara V, editor. Cassava. 2018. p. 139–61.
Gou M, Shi Z, Zhu Y, Bao Z, Wang G, Hua J. The F-box protein CPR1/CPR30 negatively regulates R protein SNC1 accumulation [Internet]. 2011/10/25. Vol. 69, The Plant journal: for cell and molecular biology. England; 2012. p. 411–20. Available from: https://pubmed.ncbi.nlm.nih.gov/21967323.
10.3389/fpls.2019.00236
Grohmann L, Keilwagen J, Duensing N, Dagand E, Hartung F, Wilhelm R, et al. Detection and Identification of Genome Editing in Plants: Challenges and Opportunities [Internet]. Vol. 10, Frontiers in Plant Science. 2019. p. 236. Available from: https://www.frontiersin.org/article/10.3389/fpls.2019.00236.
10.1186/s13059-016-1012-2
Haeussler M, Schönig K, Eckert H, Eschstruth A, Mianné J, Renaud J-B, et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR [Internet]. Vol. 17, Genome Biology. 2016. p. 148. Available from: https://doi.org/10.1186/s13059-016-1012-2.
Haglund K, Dikic I. Ubiquitylation and cell signaling [Internet]. 2005/09/08. Vol. 24, The EMBO journal. 2005. p. 3353–9. Available from: https://pubmed.ncbi.nlm.nih.gov/16148945.
Hanley-Bowdoin L, Bejarano ER, Robertson D, Mansoor S. Geminiviruses: masters at redirecting and reprogramming plant processes [Internet]. 2013/10/08. Vol. 11, Nature reviews. Microbiology. England; 2013. p. 777–88. Available from: https://pubmed.ncbi.nlm.nih.gov/24100361.
Hanley-Bowdoin L, Settlage SB, Robertson D. Reprogramming plant gene expression: a prerequisite to geminivirus DNA replication [Internet]. Vol. 5, Molecular plant pathology. England; 2004. p. 149–56. Available from: https://pubmed.ncbi.nlm.nih.gov/20565592.
Hatakeyama S, Yada M, Matsumoto M, Ishida N, Nakayama KI. U box proteins as a new family of ubiquitin-protein ligases [Internet]. 2001/07/02. Vol. 276, The Journal of biological chemistry. United States; 2001. p. 33111–20. Available from: https://pubmed.ncbi.nlm.nih.gov/11435423.
Hayashimoto A, Li Z, Murai N. A polyethylene glycol-mediated protoplast transformation system for production of fertile transgenic rice plants [Internet]. Vol. 93, Plant physiology. 1990. p. 857–63. Available from: https://pubmed.ncbi.nlm.nih.gov/16667593.
Hori K, Watanabe Y. Context analysis of termination codons in mRNA that are recognized by plant NMD [Internet]. 2007/06/13. Vol. 48, Plant & cell physiology. Japan; 2007. p. 1072–8. Available from: https://pubmed.ncbi.nlm.nih.gov/17567637.
10.1111/j.1365-313X.2005.02473.x
Hori K, Watanabe Y. UPF3 suppresses aberrant spliced mRNA in Arabidopsis [Internet]. Vol. 43, The Plant Journal. John Wiley & Sons, Ltd; 2005. p. 530–40. Available from: https://doi.org/10.1111/j.1365-313X.2005.02473.x.
10.1007/BF01277001
Huang C-N, Cornejo MJ, Bush DS, Jones RL. Estimating viability of plant protoplasts using double and single staining [Internet]. Vol. 135, Protoplasma. 1986. p. 80–7. Available from: https://doi.org/10.1007/BF01277001.
Ishii S. Factors Influencing Protoplast Viability of Suspension-Cultured Rice Cells during Isolation Process [Internet]. Vol. 88, Plant Physiology. 1988. p. 26 LP – 29. Available from: http://www.plantphysiol.org/content/88/1/26.abstract.
Jackson S, Xiong Y. CRL4s: the CUL4-RING E3 ubiquitin ligases. Vol. 34, Trends in biochemical sciences. 2009. p. 562–70.
Jeevalatha A, Siddappa S, Kumar A, Kaundal P, Guleria A, Sharma S, et al. An insight into differentially regulated genes in resistant and susceptible genotypes of potato in response to tomato leaf curl New Delhi virus-[potato] infection. Vol. 232, Virus research. Netherlands; 2017. p. 22–33.
10.3389/fpls.2016.00506
Khatodia S, Bhatotia K, Passricha N, Khurana SMP, Tuteja N. The CRISPR/Cas Genome-Editing Tool: Application in Improvement of Crops [Internet]. Vol. 7, Frontiers in Plant Science. 2016. p. 506. Available from: https://www.frontiersin.org/article/10.3389/fpls.2016.00506.
Komander D. The emerging complexity of protein ubiquitination [Internet]. Vol. 37, Biochemical Society transactions. England; 2009. p. 937–53. Available from: https://pubmed.ncbi.nlm.nih.gov/19754430.
10.3389/fmicb.2019.01460
Kumar RV. Plant Antiviral Immunity Against Geminiviruses and Viral Counter-Defense for Survival [Internet]. Vol. 10, Frontiers in Microbiology. 2019. p. 1460. Available from: https://www.frontiersin.org/article/10.3389/fmicb.2019.01460.
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms [Internet]. Vol. 35, Molecular biology and evolution. Oxford University Press; 2018. p. 1547–9. Available from: https://pubmed.ncbi.nlm.nih.gov/29722887.
Kuria P, Ilyas M, Ateka E, Miano D, Onguso J, Carrington JC, et al. Differential response of cassava genotypes to infection by cassava mosaic geminiviruses [Internet]. 2016/09/29. Vol. 227, Virus research. Elsevier Science; 2017. p. 69–81. Available from: https://pubmed.ncbi.nlm.nih.gov/27693919.
10.1371/journal.ppat.1006587
Kushwaha NK, Bhardwaj M, Chakraborty S. The replication initiator protein of a geminivirus interacts with host monoubiquitination machinery and stimulates transcription of the viral genome [Internet]. Vol. 13, PLOS Pathogens. Public Library of Science; 2017. p. e1006587. Available from: https://doi.org/10.1371/journal.ppat.1006587.
Lai J, Chen H, Teng K, Zhao Q, Zhang Z, Li Y, et al. RKP, a RING finger E3 ligase induced by BSCTV C4 protein, affects geminivirus infection by regulation of the plant cell cycle. Vol. 57, The Plant journal: for cell and molecular biology. England; 2009. p. 905–17.
Lee C-J, Liao C-L, Lin Y-L. Flavivirus activates phosphatidylinositol 3-kinase signaling to block caspase-dependent apoptotic cell death at the early stage of virus infection [Internet]. Vol. 79, Journal of virology. American Society for Microbiology; 2005. p. 8388–99. Available from: https://pubmed.ncbi.nlm.nih.gov/15956583.
10.1038/emm.2016.31
Lee KW, Kwak SH, Koo Y, Do, Cho Y-K, Lee HM, Jung HS, et al. F-box only protein 9 is an E3 ubiquitin ligase of PPARγ [Internet]. Vol. 48, Experimental & Molecular Medicine. 2016. p. e234–e234. Available from: https://doi.org/10.1038/emm.2016.31.
Lefeuvre P, Martin DP, Hoareau M, Naze F, Delatte H, Thierry M, et al. Begomovirus “melting pot” in the south-west Indian Ocean islands: molecular diversity and evolution through recombination [Internet]. Vol. 88, The Journal of general virology. England; 2007. p. 3458–68. Available from: https://pubmed.ncbi.nlm.nih.gov/18024917.
Legg JP, Owor B, Sseruwagi P, Ndunguru JBT-A in VR. Cassava Mosaic Virus Disease in East and Central Africa: Epidemiology and Management of A Regional Pandemic [Internet]. Vol. 67, Plant Virus Epidemiology. Academic Press; 2006. p. 355–418. Available from: http://www.sciencedirect.com/science/article/pii/S0065352706670103.
Legg JP, Thresh JM. Cassava mosaic virus disease in East Africa: a dynamic disease in a changing environment [Internet]. Vol. 71, Virus research. Netherlands; 2000. p. 135–49. Available from: https://pubmed.ncbi.nlm.nih.gov/11137168.
Lentz EM, Eisner S, McCallum EJ, Schlegel K, Campos F, de A de P, Gruissem W, et al. Genetic Transformation of Recalcitrant Cassava by Embryo Selection and Increased Hormone Levels [Internet]. Vol. 1, Methods and protocols. MDPI; 2018. p. 42. Available from: https://pubmed.ncbi.nlm.nih.gov/31164582.
10.1371/journal.ppat.1007607
Li P, Liu C, Deng W-H, Yao D-M, Pan L-L, Li Y-Q, et al. Plant begomoviruses subvert ubiquitination to suppress plant defenses against insect vectors [Internet]. Vol. 15, PLOS Pathogens. Public Library of Science; 2019. p. e1007607. Available from: https://doi.org/10.1371/journal.ppat.1007607.
Liao W, Li Y, Yang Y, Wang G, Peng M. Exposure to various abscission-promoting treatments suggests substantial ERF subfamily transcription factors involvement in the regulation of cassava leaf abscission [Internet]. Vol. 17, BMC genomics. BioMed Central; 2016. p. 538. Available from: https://pubmed.ncbi.nlm.nih.gov/27488048.
Libault M, Wan J, Czechowski T, Udvardi M, Stacey G. Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. Vol. 20, Molecular plant-microbe interactions: MPMI. United States; 2007. p. 900–11.
10.1186/s12870-014-0302-7
Liu L, Chung HY, Lacatus G, Baliji S, Ruan J, Sunter G. Altered expression of Arabidopsis genes in response to a multifunctional geminivirus pathogenicity protein [Internet]. Vol. 14, BMC Plant Biology. 2014. p. 302. Available from: https://doi.org/10.1186/s12870-014-0302-7.
Liu Y, Schiff M, Serino G, Deng X-W, Dinesh-Kumar SP. Role of SCF ubiquitin-ligase and the COP9 signalosome in the N gene-mediated resistance response to Tobacco mosaic virus [Internet]. Vol. 14, The Plant cell. American Society of Plant Biologists; 2002. p. 1483–96. Available from: https://pubmed.ncbi.nlm.nih.gov/12119369.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method [Internet]. Vol. 25, Methods (San Diego, Calif.). United States; 2001. p. 402–8. Available from: https://pubmed.ncbi.nlm.nih.gov/11846609.
Locatelli F, Vannini C, Magnani E, Coraggio I, Bracale M. Efficiency of transient transformation in tobacco protoplasts is independent of plasmid amount [Internet]. 2003/03/07. Vol. 21, Plant cell reports. Germany; 2003. p. 865–71. Available from: https://pubmed.ncbi.nlm.nih.gov/12789504.
10.1007/s10722-005-6841-x
Lokko Y, Dixon A, Offei S, Danquah E, Fregene M. Assessment of genetic diversity among African cassava Manihot esculenta Grantz accessions resistant to the cassava mosaic virus disease using SSR markers [Internet]. Vol. 53, Genetic Resources and Crop Evolution. 2006. p. 1441–53. Available from: https://doi.org/10.1007/s10722-005-6841-x.
Lozano R, Hamblin MT, Prochnik S, Jannink J-L. Identification and distribution of the NBS-LRR gene family in the Cassava genome [Internet]. Vol. 16, BMC genomics. BioMed Central; 2015. p. 360. Available from: https://pubmed.ncbi.nlm.nih.gov/25948536.
10.1111/nph.13564
Lozano-Durán R. Geminiviruses for biotechnology: the art of parasite taming [Internet]. Vol. 210, New Phytologist. John Wiley & Sons, Ltd; 2016. p. 58–64. Available from: https://doi.org/10.1111/nph.13564.
Lozano-Duran R, Bejarano E. Geminiviral Co-option of Post-Translational Modification Pathways. In 2013.
Lozano-Duran R, Bejarano ER. Geminivirus C2 protein might be the key player for geminiviral co- option of SCF-mediated ubiquitination [Internet]. Vol. 6, Plant signaling & behavior. Landes Bioscience; 2011. p. 999–1001. Available from: https://pubmed.ncbi.nlm.nih.gov/21691154.
Machida K, Cheng KT-N, Sung VM-H, Shimodaira S, Lindsay KL, Levine AM, et al. Hepatitis C virus induces a mutator phenotype: enhanced mutations of immunoglobulin and protooncogenes [Internet]. 2004/03/03. Vol. 101, Proceedings of the National Academy of Sciences of the United States of America. National Academy of Sciences; 2004. p. 4262–7. Available from: https://pubmed.ncbi.nlm.nih.gov/14999097.
10.1093/nsr/nwz005
Mao Y, Botella JR, Liu Y, Zhu J-K. Gene editing in plants: progress and challenges [Internet]. Vol. 6, National Science Review. 2019. p. 421–37. Available from: https://doi.org/10.1093/nsr/nwz005.
10.1186/s13059-018-1529-7
Mao Y, Yang X, Zhou Y, Zhang Z, Botella JR, Zhu J-K. Manipulating plant RNA-silencing pathways to improve the gene editing efficiency of CRISPR/Cas9 systems [Internet]. Vol. 19, Genome Biology. 2018. p. 149. Available from: https://doi.org/10.1186/s13059-018-1529-7.
10.1371/journal.pone.0096642
Maruthi MN, Bouvaine S, Tufan HA, Mohammed IU, Hillocks RJ. Transcriptional Response of Virus-Infected Cassava and Identification of Putative Sources of Resistance for Cassava Brown Streak Disease [Internet]. Vol. 9, PLOS ONE. Public Library of Science; 2014. p. e96642. Available from: https://doi.org/10.1371/journal.pone.0096642.
Mazzucotelli E, Belloni S, Marone D, De Leonardis A, Guerra D, Di Fonzo N, et al. The e3 ubiquitin ligase gene family in plants: regulation by degradation [Internet]. Vol. 7, Current genomics. Bentham Science Publishers Ltd.; 2006. p. 509–22. Available from: https://pubmed.ncbi.nlm.nih.gov/18369404.
Miozzi L, Napoli C, Sardo L, Accotto GP. Transcriptomics of the interaction between the monopartite phloem-limited geminivirus tomato yellow leaf curl Sardinia virus and Solanum lycopersicum highlights a role for plant hormones, autophagy and plant immune system fine tuning during infection [Internet]. Vol. 9, PloS one. Public Library of Science; 2014. p. e89951–e89951. Available from: https://pubmed.ncbi.nlm.nih.gov/24587146.
10.1371/journal.ppat.1007810
Montes N, Alonso-Blanco C, García-Arenal F. Cucumber mosaic virus infection as a potential selective pressure on Arabidopsis thaliana populations. PLOS Pathog [Internet]. 2019 May 28;15(5):e1007810. Available from: https://doi.org/10.1371/journal.ppat.1007810.
Moreno I, Gruissem W, Vanderschuren H. Reference genes for reliable potyvirus quantitation in cassava and analysis of Cassava brown streak virus load in host varieties [Internet]. 2011/07/02. Vol. 177, Journal of virological methods. Netherlands; 2011. p. 49–54. Available from: https://pubmed.ncbi.nlm.nih.gov/21756941.
Morreale FE, Walden H. Types of Ubiquitin Ligases [Internet]. Vol. 165, Cell. United States; 2016. p. 248–248.e1. Available from: https://pubmed.ncbi.nlm.nih.gov/27015313.
Murashige T, Skoog F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Vol. 15, Physiologia Plantarum. 2006. p. 473–97.
Nanjareddy K, Arthikala M-K, Blanco L, Arellano ES, Lara M. Protoplast isolation, transient transformation of leaf mesophyll protoplasts and improved Agrobacterium-mediated leaf disc infiltration of Phaseolus vulgaris: tools for rapid gene expression analysis [Internet]. Vol. 16, BMC biotechnology. BioMed Central; 2016. p. 53. Available from: https://pubmed.ncbi.nlm.nih.gov/27342637.
Nzuki I, Katari MS, Bredeson JV, Masumba E, Kapinga F, Salum K, et al. QTL Mapping for Pest and Disease Resistance in Cassava and Coincidence of Some QTL with Introgression Regions Derived from Manihot glaziovii [Internet]. Vol. 8, Frontiers in plant science. Frontiers Media S.A.; 2017. p. 1168. Available from: https://pubmed.ncbi.nlm.nih.gov/28785268.
10.2135/cropsci2006.10.0688
Okogbenin E, Porto MCM, Egesi C, Mba C, Espinosa E, Santos LG, et al. Marker-Assisted Introgression of Resistance to Cassava Mosaic Disease into Latin American Germplasm for the Genetic Improvement of Cassava in Africa [Internet]. Vol. 47, Crop Science. Madison, WI: Crop Science Society of America; 2007. p. 1895–904. Available from: http://dx.doi.org/10.2135/cropsci2006.10.0688.
Patanun O, Ueda M, Itouga M, Kato Y, Utsumi Y, Matsui A, et al. The Histone Deacetylase Inhibitor Suberoylanilide Hydroxamic Acid Alleviates Salinity Stress in Cassava [Internet]. Vol. 7, Frontiers in plant science. Frontiers Media S.A.; 2017. p. 2039. Available from: https://pubmed.ncbi.nlm.nih.gov/28119717.
Pickart CM. Mechanisms underlying ubiquitination [Internet]. Vol. 70, Annual review of biochemistry. United States; 2001. p. 503–33. Available from: https://pubmed.ncbi.nlm.nih.gov/11395416.
10.1371/journal.pone.0067534
Pierce EJ, Rey MEC. Assessing Global Transcriptome Changes in Response to South African Cassava Mosaic Virus [ZA-99] Infection in Susceptible Arabidopsis thaliana [Internet]. Vol. 8, PLOS ONE. Public Library of Science; 2013. p. e67534. Available from: https://doi.org/10.1371/journal.pone.0067534.
Punga T, Bühler M. Long intronic GAA repeats causing Friedreich ataxia impede transcription elongation [Internet]. Vol. 2, EMBO molecular medicine. WILEY-VCH Verlag; 2010. p. 120–9. Available from: https://pubmed.ncbi.nlm.nih.gov/20373285.
Ramesh SV, Sahu PP, Prasad M, Praveen S, Pappu HR. Geminiviruses and Plant Hosts: A Closer Examination of the Molecular Arms Race [Internet]. Vol. 9, Viruses. MDPI; 2017. p. 256. Available from: https://pubmed.ncbi.nlm.nih.gov/28914771.
Rey C, Vanderschuren H. Cassava Mosaic and Brown Streak Diseases: Current Perspectives and Beyond. Vol. 4, Annual review of virology. United States; 2017. p. 429–52.
PLOS ONE

10.1371/journal.pone.0147251
Rogans SJ, Rey C. Unveiling the Micronome of Cassava (Manihot esculenta Crantz) [Internet]. Vol. 11, PLOS ONE. Public Library of Science; 2016. p. e0147251. Available from: https://doi.org/10.1371/journal.pone.0147251.
Rosas-Díaz T, Macho PA, Beuzón RC, Lozano-Durán R, Bejarano RE. The C2 Protein from the Geminivirus Tomato Yellow Leaf Curl Sardinia Virus Decreases Sensitivity to Jasmonates and Suppresses Jasmonate-Mediated Defences. Vol. 5, Plants. 2016.
10.1093/nar/gkz342
Rozewicki J, Li S, Amada KM, Standley DM, Katoh K. MAFFT-DASH: integrated protein sequence and structural alignment [Internet]. Vol. 47, Nucleic Acids Research. 2019. p. W5–10. Available from: https://doi.org/10.1093/nar/gkz342.
10.1111/j.1469-8137.2012.04266.x
Sadanandom A, Bailey M, Ewan R, Lee J, Nelis S. The ubiquitin–proteasome system: central modifier of plant signalling [Internet]. Vol. 196, New Phytologist. John Wiley & Sons, Ltd; 2012. p. 13–28. Available from: https://doi.org/10.1111/j.1469-8137.2012.04266.x.
10.1007/s10142-013-0346-z
Sahu PP, Sharma N, Puranik S, Muthamilarasan M, Prasad M. Involvement of host regulatory pathways during geminivirus infection: a novel platform for generating durable resistance [Internet]. Vol. 14, Functional & Integrative Genomics. 2014. p. 47–58. Available from: https://doi.org/10.1007/s10142-013-0346-z.
Sander JD, Joung JK. CRISPR-Cas systems for editing, regulating and targeting genomes [Internet]. 2014/03/02. Vol. 32, Nature biotechnology. 2014. p. 347–55. Available from: https://pubmed.ncbi.nlm.nih.gov/24584096.
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method [Internet]. Vol. 3, Nature protocols. England; 2008. p. 1101–8. Available from: https://pubmed.ncbi.nlm.nih.gov/18546601.
Shahin EA, Shepard JF. Cassava mesophyll protoplasts: Isolation, proliferation, and shoot formation [Internet]. Vol. 17, Plant Science Letters. 1980. p. 459–65. Available from: http://www.sciencedirect.com/science/article/pii/0304421180901339.
Shen Q, Hu T, Bao M, Cao L, Zhang H, Song F, et al. Tobacco RING E3 Ligase NtRFP1 Mediates Ubiquitination and Proteasomal Degradation of a Geminivirus-Encoded βC1 [Internet]. 2016/03/24. Vol. 9, Molecular plant. England; 2016. p. 911–25. Available from: https://pubmed.ncbi.nlm.nih.gov/27018391.
Silke J, Meier P. Inhibitor of apoptosis (IAP) proteins-modulators of cell death and inflammation [Internet]. Vol. 5, Cold Spring Harbor perspectives in biology. Cold Spring Harbor Laboratory Press; 2013. p. a008730. Available from: https://pubmed.ncbi.nlm.nih.gov/23378585.
Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees [Internet]. Vol. 10, Molecular biology and evolution. United States; 1993. p. 512–26. Available from: https://pubmed.ncbi.nlm.nih.gov/8336541.
Tang AF. Process and nutrient medium for micropropagation of cassava. [Internet]. USA; 4473648, 1882. Available from: https://patents.google.com/patent/US4473648A/en.
Trinks D, Rajeswaran R, Shivaprasad PV, Akbergenov R, Oakeley EJ, Veluthambi K, et al. Suppression of RNA silencing by a geminivirus nuclear protein, AC2, correlates with transactivation of host genes [Internet]. Vol. 79, Journal of virology. American Society for Microbiology; 2005. p. 2517–27. Available from: https://pubmed.ncbi.nlm.nih.gov/15681452.
Uchimiya H, Murashige T. Evaluation of parameters in the isolation of viable protoplasts from cultured tobacco cells [Internet]. Vol. 54, Plant physiology. 1974. p. 936–44. Available from: https://pubmed.ncbi.nlm.nih.gov/16659004.
Vanderschuren H, Stupak M, Fütterer J, Gruissem W, Zhang P. Engineering resistance to geminiviruses–review and perspectives [Internet]. Vol. 5, Plant biotechnology journal. Institute of Plant Sciences, ETH Zurich, Universitätstrasse 2, 8092 Zurich, Switzerland.; 2007. p. 207–20. Available from: http://europepmc.org/abstract/MED/17309676.
Vanitharani R, Chellappan P, Fauquet CM. Short interfering RNA-mediated interference of gene expression and viral DNA accumulation in cultured plant cells [Internet]. Vol. 100, Proceedings of the National Academy of Sciences. 2003. p. 9632 LP – 9636. Available from: http://www.pnas.org/content/100/16/9632.abstract.
Verchot J. Plant Virus Infection and the Ubiquitin Proteasome Machinery: Arms Race along the Endoplasmic Reticulum [Internet]. Vol. 8, Viruses. MDPI; 2016. p. 314. Available from: https://pubmed.ncbi.nlm.nih.gov/27869775.
Voinnet O, Pinto YM, Baulcombe DC. Suppression of gene silencing: A general strategy used by diverse DNA and RNA viruses of plants [Internet]. Vol. 96, Proceedings of the National Academy of Sciences. 1999. p. 14147 LP – 14152. Available from: http://www.pnas.org/content/96/24/14147.abstract.
10.1111/j.1365-313X.2004.02219.x
Walter M, Chaban C, Schütze K, Batistic O, Weckermann K, Näke C, et al. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation [Internet]. Vol. 40, The Plant Journal. John Wiley & Sons, Ltd; 2004. p. 428–38. Available from: https://doi.org/10.1111/j.1365-313X.2004.02219.x.
Wang L, Tan H, Wu M, Jimenez-Gongora T, Tan L, Lozano-Duran R Dynamic Virus-Dependent Subnuclear Localization of the Capsid Protein from a Geminivirus [Internet]. Vol. 8, Frontiers in plant science. Frontiers Media S.A.; 2017. p. 2165. Available from: https://pubmed.ncbi.nlm.nih.gov/29312406.
10.1186/1743-422X-10-325
Wang Q, Tao T, Han Y, Chen X, Fan Z, Li D, et al. Nonstructural protein P7-2 encoded by Rice black-streaked dwarf virus interacts with SKP1, a core subunit of SCF ubiquitin ligase [Internet]. Vol. 10, Virology Journal. 2013. p. 325. Available from: https://doi.org/10.1186/1743-422X-10-325.
10.1093/nar/gkq537
Warde-Farley D, Donaldson SL, Comes O, Zuberi K, Badrawi R, Chao P, et al. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function [Internet]. Vol. 38, Nucleic Acids Research. 2010. p. W214–20. Available from: https://doi.org/10.1093/nar/gkq537.
Wellink J, van Lent JW, Verver J, Sijen T, Goldbach RW, van Kammen A. The cowpea mosaic virus M RNA-encoded 48-kilodalton protein is responsible for induction of tubular structures in protoplasts [Internet]. Vol. 67, Journal of virology. 1993. p. 3660–4. Available from: https://pubmed.ncbi.nlm.nih.gov/8497075.
10.3835/plantgenome2015.11.0118
Wolfe MD, Rabbi IY, Egesi C, Hamblin M, Kawuki R, Kulakow P, et al. Genome-Wide Association and Prediction Reveals Genetic Architecture of Cassava Mosaic Disease Resistance and Prospects for Rapid Genetic Improvement [Internet]. Vol. 9, The plant genome. United States; 2016. p. 10.3835/plantgenome2015.11.0118. Available from: https://pubmed.ncbi.nlm.nih.gov/27898832.
10.1186/1746-4811-5-16
Wu F-H, Shen S-C, Lee L-Y, Lee S-H, Chan M-T, Lin C-S. Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method [Internet]. Vol. 5, Plant Methods. 2009. p. 16. Available from: https://doi.org/10.1186/1746-4811-5-16.
Wu J-Z, Liu Q, Geng X-S, Li K-M, Luo L-J, Liu J-P. Highly efficient mesophyll protoplast isolation and PEG-mediated transient gene expression for rapid and large-scale gene characterization in cassava (Manihot esculenta Crantz) [Internet]. Vol. 17, BMC biotechnology. BioMed Central; 2017. p. 29. Available from: https://pubmed.ncbi.nlm.nih.gov/28292294.
10.1186/s12864-019-5842-7
Wu M, Ding X, Fu X, Lozano-Duran R. Transcriptional reprogramming caused by the geminivirus Tomato yellow leaf curl virus in local or systemic infections in Nicotiana benthamiana [Internet]. Vol. 20, BMC Genomics. 2019. p. 542. Available from: https://doi.org/10.1186/s12864-019-5842-7.
Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction [Internet]. Vol. 12, Nature methods. 2015. p. 7–8. Available from: https://pubmed.ncbi.nlm.nih.gov/25549265.
Yoo S-D, Cho Y-H, Sheen J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis [Internet]. Vol. 2, Nature protocols. England; 2007. p. 1565–72. Available from: https://pubmed.ncbi.nlm.nih.gov/17585298.
10.1186/1746-4811-8-24
Zainuddin IM, Schlegel K, Gruissem W, Vanderschuren H. Robust transformation procedure for the production of transgenic farmer-preferred cassava landraces [Internet]. Vol. 8, Plant Methods. 2012. p. 24. Available from: https://doi.org/10.1186/1746-4811-8-24.
Zerbini FM, Briddon RW, Idris A, Martin DP, Moriones E, Navas-Castillo J, et al. ICTV Virus Taxonomy Profile: Geminiviridae. Vol. 98, The Journal of general virology. England; 2017. p. 131–3.
10.3389/fimmu.2018.01083
Zhang Y, Li L-F, Munir M, Qiu H-J. RING-Domain E3 Ligase-Mediated Host–Virus Interactions: Orchestrating Immune Responses by the Host and Antagonizing Immune Defense by Viruses [Internet]. Vol. 9, Frontiers in Immunology. 2018. p. 1083. Available from: https://www.frontiersin.org/article/10.3389/fimmu.2018.01083.
Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences [Internet]. Vol. 7, Journal of computational biology: a journal of computational molecular cell biology. United States; 2000. p. 203–14. Available from: https://pubmed.ncbi.nlm.nih.gov/10890397.
10.1146/annurev-phyto-082712-102234
Zhou X. Advances in Understanding Begomovirus Satellites [Internet]. Vol. 51, Annual Review of Phytopathology. Annual Reviews; 2013. p. 357–81. Available from: https://doi.org/10.1146/annurev-phyto-082712-102234.
10.1093/nar/gkg595
Zuker M. Mfold web server for nucleic acid folding and hybridization prediction [Internet]. Vol. 31, Nucleic Acids Research. 2003. p. 3406–15. Available from: https://doi.org/10.1093/nar/gkg595.

Download PDF

Journal Publication

published 23 Nov, 2020

Read the published version in Virology Journal →

Editorial decision: Major revision
16 Aug, 2020
Review #1 received at journal
14 Aug, 2020
Review #2 received at journal
14 Aug, 2020
Review #3 received at journal
14 Aug, 2020
Reviewer #2 agreed at journal
31 Jul, 2020
Reviewer #3 agreed at journal
31 Jul, 2020
Reviewers invited by journal
29 Jul, 2020
Reviewer #1 agreed at journal
29 Jul, 2020
Editor assigned by journal
28 Jul, 2020
Editor invited by journal
27 Jul, 2020
Submission checks completed at journal
23 Jul, 2020
First submitted to journal
20 Jul, 2020

You are reading this older preprint version

Read the latest preprint version →

Susceptibility to South African cassava mosaic virus is Associated with a RING Finger E3 Ubiquitin Ligase

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods and Materials

Results

1. Isolation and transformation of cassava protoplasts

2. Structure and phylogenetic analysis ofMeE3Lin model, susceptible and tolerant cassava genotypes

3. Relative accumulation of SACMV DNA and relativeMeE3Lexpression in transformed cassava protoplasts

4. Predicted MeE3L primary structure in transformed cassava protoplasts

Discussion

1. African cassava landraces susceptible and tolerant to SACMV are amenable to enzymatic protoplast isolation and PEG-mediated transformation

2. **The M. esculenta T200 MeE3L encodes a truncated RING-less protein due to a nonsense mutation**

3. MeE3L affects SACMV DNA accumulation in a genotype-dependent manner

4. Viral activity and gene editing of MeE3L affect the expression of MeE3L

5. SACMV’s interaction with a tolerant cassava genotype induces numerous mutations in MeE3L

6. The response of MeE3L to SACMV is virus- and host-specific

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Consent to publication

Availability of data and materials

Competing Interests

Funding

Authors’ contributions

Acknowledgements

References

Supplementary Files

Status:

Journal Publication

Version 1

Susceptibility to South African cassava mosaic virus is Associated with a RING Finger E3 Ubiquitin Ligase

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods and Materials

Results

1. Isolation and transformation of cassava protoplasts

2. Structure and phylogenetic analysis ofMeE3Lin model, susceptible and tolerant cassava genotypes

3. Relative accumulation of SACMV DNA and relativeMeE3Lexpression in transformed cassava protoplasts

4. Predicted MeE3L primary structure in transformed cassava protoplasts

Discussion

1. African cassava landraces susceptible and tolerant to SACMV are amenable to enzymatic protoplast isolation and PEG-mediated transformation

2. The M. esculenta T200 MeE3L encodes a truncated RING-less protein due to a nonsense mutation

3. MeE3L affects SACMV DNA accumulation in a genotype-dependent manner

4. Viral activity and gene editing of MeE3L affect the expression of MeE3L

5. SACMV’s interaction with a tolerant cassava genotype induces numerous mutations in MeE3L

6. The response of MeE3L to SACMV is virus- and host-specific

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Consent to publication

Availability of data and materials

Competing Interests

Funding

Authors’ contributions

Acknowledgements

References

Supplementary Files

Status:

Journal Publication

Version 1

2. **The M. esculenta T200 MeE3L encodes a truncated RING-less protein due to a nonsense mutation**