The experimental approach to the problem
This study aimed to determine the effectiveness of 12 weeks of yoga training with the supplementation of VD on Qol and inflammatory markers in BC survivors. This study was a randomized, controlled trial with pre and post-tests. A few oncologists introduced eligible subjects to participate in the study. Initially, based on the initial level of VD, the subjects were divided into three groups randomly by a third person who was not in the research group. Pre- and post-intervention, Qol questioner, and handgrip strength tests were taken by the third assessor. In addition, blood sampling was taken, and circulatory levels of IL-6, IL-10, and TNF-α and their gene expressions in leukocytes were measured by a specific Elisa kit.
Participants
After the oncologists were informed of the research objectives, they introduced the subjects. Inclusion criteria were completed chemotherapy and radiotherapy, not have any acute medical disorders (cardiovascular diseases, diabetes), and not have any orthopedic conditions. The sample size was calculated by using G*Power Software version 3.1.9.6 (Düsseldorf, Germany). The estimated number of patients needed to assume a rejection criterion of 0.05 and 0.85 (1-beta) power, and a large effect (f=0.65), was 10 persons per group, depending on the statistical test used. Thirty-three BC survivors who met inclusion criteria volunteered to participate in the study, but the data of 30 participants (age: 47.90± 7.95 years; height: 160.93± 6.12 cm, body mass: 72.62± 11.72kg) were obtained and analyzed finally. Exclusion criteria were getting worse a medical situation (n=1), do not participate in more than four consecutive training sessions (n=1), not interested in continue intervention, not complete the post-test (n=1), and the physician would diagnose she must withdraw from the study. The third person randomly divided participants into a high dose (4000 IU) of VD supplementation (HVD) group (n=10), yoga with a high dose (4000 IU) of VD (Y-HVD) group (n=10), and yoga with a low dose (2000 IU) of VD (Y-LVD) group (n=10). It seems that we needed a group that only practices yoga, but all cancer survivors consume different doses of VD, so due to ethical reasons, we could not put that group.
Measurements
Physical Measurements
All measurements were conducted by a third person who was not in our research team. By a height scale (Seca 206, Hamburg, Germany) and a digital body weight scale (Seca 803, Hamburg, Germany), height and body mass were measured, respectively. Also, by using a Lange skinfold caliper (beta technology Inc, Cambridge, MD USA), body fat percentage (BF %) was estimated by assessing subcutaneous fat of seven skinfold sites based on Jackson and Pollock's instructions 34.
Handgrip strength tests
A hand dynamometer with an adjustable grip (TKK 5101 Grip D; Takey, Tokyo, Japan) was used to assess handgrip strength. Participants performed two attempts with both hands, with the arm fully extended, forming an angle of 30° with respect to the trunk. The maximum score in kilograms for each hand was recorded, and the mean score of both hands was used in the statistical analyses.
Quality of life
European Organization for Research and Treatment of Cancer Questionnaire (EORTC- QLQ-C30) developed to assess the quality of life of cancer patients. The validity and reliability of this questionnaire were confirmed in the Iranian cancer population 35. It consists of 30 questions that assess the global health, symptoms (fatigue, pain, nausea, and vomiting), and functional (physical, role, cognitive, emotional, and social) scales. Higher scores in global health and functional scales and a lower score in symptoms indicate better situations.
Vitamin D supplementation
Participants in the HVD and Y-HVD groups received VD tablets at 4,000 IU daily, and individuals in the Y-LVD group consumed 2,000 IU daily.
Yoga protocol
A female certified yoga coach conducted yoga classes. Participants performed yoga twice a week, with each class lasting around 60-90 minutes for twelve weeks. Exercises were selected from the Hatha yoga style and included Asana (physical postures), pranayama (breath control), and Dyana (meditation). The yoga exercises begin with Pranayama (yoga mudra, Respiratory coordination ), then asana (such as Marjaryasana cycle, Balasana, Hindolasana, Bhujangasana, Setu Bandha, Bitilasana, Surya namaskar, Baddha Konasana, Chakki Chalanasana, Utkatasana, Supta Baddha Konasana, Bhujangasana, kriya cycle, Salabhasana, Ardha Pavana Muktasana, Pavanamuktasana, suptaVakra Asana) and ended with dyana (Savasana). In order to monitor the intensity of yoga, the Borg Rating of Perceived Exertion (RPE) scale (6-19 score) was gathered after finishing every workout.
Cytokines assessments
A medical laboratory expert collected the blood samples in overnight fasting from an antecubital vein into 5cc Ethylenediaminetetraacetic acid (EDTA) tubes. Samples were spun at 3000 rpm in a 4°C centrifuge for 10 minutes, and separated serum was stored in a -20°C freezer for later analysis. Specific human enzyme-linked immunosorbent assay [ELISA] kits were used to determine serum level of IL-10, TNF-α and IL-6 [DuoSet ELISA, R&D Systems, Minneapolis, MN]. The intra- and inter- assay coefficients of variation were less than 8%.
Also, a buffy coat layer was removed using a suspension technic and stored at –70 °C freezer. RNA samples were extracted using the total RNA extraction Kit (Takara, Japan), and cDNA synthesis was performed using the Takara cDNA synthesis kit (Takara, Japan) according to the manufacturer's instructions. Real-time PCR was performed using the SYBR Green Master Mix kit (Ampliqon, Denmark). The thermal cycling program was as follows: 94 °C for 5 min followed by 40 cycles of 95 °C for 30 s, 54 °C for 45 s, and 72 °C for 30 s. GAPDH mRNA for the normalization of the gene expression analysis was used. The sequence of PCR primers used for the amplification of the protein-coding genes was as follow: IL-6 forward "GTGAGGAACAAGCCAGAGCA ", IL-6 reverse "TGGCATTTGTGGTTGGGTCA"; IL-10 forward “CTTTAAGGGTTACCTGGGTTGC", IL-10 reverse "CTCACTCATGGCTTTGTAGACAC"; TNF-α forward "CTCCCTCTCATCAGTTCCAT" and TNF-α reverse "CAGTTGGTTGTCTTTGAGATC"; GAPDH forward "CGAGATCCCTCCAAAATCAA" GAPDH reverse "AGGTCAGGTCCACCACTGAC". The fold change expression was calculated using the 2-∆∆CT formula.
Statistical analysis
We used the Statistical Package of Social Sciences (SPSS, IBM, v19) to analyses row data. Data present by mean ± standard deviation (SD). Shapiro-Wilk analysis confirms data normality. A paired t-test was used to interpret the within-group difference, and an analysis of covariance (ANCOVA) was used to analyze the effects of interventions on the variables. Pre-test data was considered as a covariate. If significant effects were found, Bonferroni post-hoc tests were done. Data of gene expression changes were analyzed by ANOVA. To define the magnitude and direction of the linear relationship between circulatory markers with anthropometric indicators and QoL indicators, the bivariate Pearson correlation coefficient (r) was used on the magnitude of changes. The magnitude of changes was calculated by subtracting post-test values from pre-test values. Effect sizes (ES) were also calculated by the change score divided by the SD of the change score to examine the magnitude of differences while controlling for the influence of the sample size 36 with 0.2 considered as a small ES, 0.2-0.5 as a moderate ES, 0.5-0.8 as a large ES, and > 0.8 as a very large ES. The changes percentage was calculated by formula:
. The significance level was set at p≤0.05 for all statistical analyses.